BBa_K1363600 1 BBa_K1363600 a aptamyze regulator sensetive to Theophylline 2014-09-28T11:00:00Z 2015-05-08T01:10:07Z from paper the part was created to test the ability of modifying RNA exprssion, in front of gfp false false _1739_ 0 23622 9 It's complicated false put ot in front of any protein false Hanjia Tang BBa_K1363600_sequence 1 tttacactttatgcttccggctcgtatgttgtgtggactcagatgcaggtacatccagctgatgagtcccaaataggacgaaatacatacataccagccgaaggcccttggcaggtgtcctggattccactgctatccac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z