BBa_K1363601 1 BBa_K1363601 the gate of yes of RNA logic gates 2014-09-28T11:00:00Z 2015-05-08T01:10:07Z sangon the gate RNA will be activited when combined with the short RNA key-of-yes false false _1739_ 0 23622 9 It's complicated false put it before a protein false Hanjia Tang BBa_K1363601_sequence 1 tgtaagtttatacataggcgagtactctgttatgggggcgaccctgatgagcttgagtttagctcgtcactgtccaggttcaatcaggcgaaacggtgaaagccgtaggttgccctctagagaaagacaggacccactag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z