BBa_K1363602 1 BBa_K1363602 key of yes of RNA logic gates 2014-09-28T11:00:00Z 2015-05-08T01:10:07Z syntheted by sangon the short RNA activity the gate-of-yes and start cleavage false false _1739_ 0 23622 9 It's complicated false a part work itself false Hanjia Tang BBa_K1363602_sequence 1 tttacactttatgcttccggctcgtatgttgtgtggatgaacctggacagtgacgacgagcttcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z