BBa_K1363603 1 BBa_K1363603 gate of no of RNA logic gates 2014-09-28T11:00:00Z 2015-05-08T01:10:07Z sangon the gate is a ribozyme whose activity is repressed when combined with key-of-no false false _1739_ 0 23622 9 It's complicated false put it in front of a protein false Hanjia Tang BBa_K1363603_sequence 1 tgtaagtttatacataggcgagtactctgttatggggcaggttacatacagctgatgagtcccaaataggacgaaacgcgacacacaccactaaaccgtgcagtgttttgcgtcctgtattccactgctctagagaaagacaggacccactagactagtagcggccgctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z