BBa_K1363605 1 BBa_K1363605 gate of and of RNA logic gates 2014-09-28T11:00:00Z 2015-05-08T01:10:07Z sangon the ribozyme is activited when combined both key-of-and-1 and key-of-and-2. false false _1739_ 0 23622 9 It's complicated false put it in front of a protein. false Hanjia Tang BBa_K1363605_sequence 1 tgtaagtttatacataggcgagtactctgttatgggggcgaccctgatgagcttggtttagtatttacagctccatacatgaggtgttatccctatgcatctagagaaagacaggacccactag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z