BBa_K1363607 1 BBa_K1363607 key-2 of and-gate of RNA logic gates 2014-09-28T11:00:00Z 2015-05-08T01:10:07Z sangon it activate the gate-of-and when combining to it togther with key-of-and-1. false false _1739_ 0 23622 9 It's complicated false the part works itself. false Hanjia Tang BBa_K1363607_sequence 1 gccgtgattatagacacttttgttacgcgtttttgtcatggctttggtgcatagggataacactcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z