BBa_K1364002 1 GAFP-1 RBS - Antifungal GAFP-1 2014-09-30T11:00:00Z 2015-06-08T08:39:49Z This gene was ordered from a synthesis company. The Gastrodia anti-fungal protein (GAFP-1) is a mannose-binding lectin which is able to inhibit the growth of multiples species of plant pathogenic fungi. The RBS used is a strong RBS for Bacillus subtilis (K780002). false false _1740_ 4206 21466 9 In stock false This part is composed of a Strong RBS (K780002) and the open reading frame of the Gastrodia anti-fungal protein 1 (GAFP-1) optimized for its expression and its secretion in Bacillus subtilis. The codon optimization was made thanks to the DNA 2.0 software program. false Manon Molina annotation2391441 1 Signal peptide range2391441 1 17 97 annotation2391443 1 GAFP-1 range2391443 1 140 187 annotation2391440 1 strong RBS K780002 range2391440 1 1 16 annotation2391442 1 Propeptide range2391442 1 98 139 BBa_K1364002_sequence 1 agagaacaaggaggggatgtttgcaaagagatttaagacgagtttacttccgctgtttgccggcttccttttgctgtttcaccttgtattagccggtcctgcggcagcaagtgcggaaacggctaacaaaagtaacgagctggatagcctttccttttcatataataatttcgaagaggacgattaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z