BBa_K1364003 1 D4E1 RBS - Antifungal D4E1 - Double terminator 2014-09-24T11:00:00Z 2016-02-03T10:04:36Z De Lucca AJ,??Bland JM,??Grimm C,??Jacks TJ,??Cary JW,??Jaynes JM,??Cleveland TE,??Walsh TJ. Fungicidal properties, sterol binding, and proteolytic resistance of the synthetic peptide D4E1. Can J Microbiol.??1998 Jun;44(6):514-20. D4E1 is a linear synthetic peptide of 17 amino acids which has shown to have antifungal activities by complexing with a sterol present in conidial wall of a variety of fungi. This part is composed of a RBS (K780002 spoVG), the open reading frame of D4E1 and a double terminator (B0015). This part was optimized for the expression and its secretion in Bacillus subtilis. false false _1740_ 4206 21465 9 In stock false The coding sequence of D4E1 is flanked on the N-terminal end with a signal peptide (amyE signal peptide) followed by a pro peptide, cleaved during the secretion process. false Jourdan Camille annotation2386386 1 D4E1 range2386386 1 140 192 annotation2386383 1 BBa_K780002 strong RBS range2386383 1 1 16 annotation2386384 1 Signal Peptide range2386384 1 17 97 annotation2386387 1 BBa_B0015 range2386387 1 194 322 annotation2386385 1 Pro Peptide range2386385 1 98 139 BBa_K1364003_sequence 1 agagaacaaggaggggatgtttgcaaagagatttaagacgagtttacttccgctgtttgccggcttccttttgctgtttcaccttgtattagccggtcctgcggcagcaagtgcggaaacggctaacaaaagtaacgagttcaagttacgggcgaaaatcaaagtacggctgcgggcgaagatcaagctatgaccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z