BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K1364007 1 GAFP-1 RBS + Antifungal GAFP-1 + Double terminator 2014-10-02T11:00:00Z 2015-06-08T08:40:49Z bla bla bla false false _1740_ 4206 21465 9 In stock false bla false Jourdan Camille component2392847 1 BBa_K1364002 component2392854 1 BBa_B0015 annotation2392854 1 BBa_B0015 range2392854 1 196 324 annotation2392847 1 BBa_K1364002 range2392847 1 1 187 BBa_K1364002 1 GAFP-1 RBS - Antifungal GAFP-1 2014-09-30T11:00:00Z 2015-06-08T08:39:49Z This gene was ordered from a synthesis company. The Gastrodia anti-fungal protein (GAFP-1) is a mannose-binding lectin which is able to inhibit the growth of multiples species of plant pathogenic fungi. The RBS used is a strong RBS for Bacillus subtilis (K780002). false false _1740_ 4206 21466 9 In stock false This part is composed of a Strong RBS (K780002) and the open reading frame of the Gastrodia anti-fungal protein 1 (GAFP-1) optimized for its expression and its secretion in Bacillus subtilis. The codon optimization was made thanks to the DNA 2.0 software program. false Manon Molina annotation2391441 1 Signal peptide range2391441 1 17 97 annotation2391440 1 strong RBS K780002 range2391440 1 1 16 annotation2391443 1 GAFP-1 range2391443 1 140 187 annotation2391442 1 Propeptide range2391442 1 98 139 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1364007_sequence 1 agagaacaaggaggggatgtttgcaaagagatttaagacgagtttacttccgctgtttgccggcttccttttgctgtttcaccttgtattagccggtcctgcggcagcaagtgcggaaacggctaacaaaagtaacgagctggatagcctttccttttcatataataatttcgaagaggacgattaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1364002_sequence 1 agagaacaaggaggggatgtttgcaaagagatttaagacgagtttacttccgctgtttgccggcttccttttgctgtttcaccttgtattagccggtcctgcggcagcaagtgcggaaacggctaacaaaagtaacgagctggatagcctttccttttcatataataatttcgaagaggacgattaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z