BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K143012 1 Pveg Promoter veg a constitutive promoter for B. subtilis 2008-09-10T11:00:00Z 2015-05-08T01:10:23Z The Pveg promoter was suggested to us by Dr. Jan-Willem Veening of Newcastle University. This sequence supplied was compared to that of the DBTBS database<cite>#3</cite> then a section containing the binding site synthesised by Geneart. Released HQ 2013 Pveg is a constitutive promoter that constitutively expresses the P43 protein in ''B.subtilis''. Pveg contains binding sites for the ''B.sutbilis'' major sigma factor<cite>#1</cite>. Pveg in ''B.subtilis'' utilises two binding sites to cause high expression of genes<cite>#2</cite>, however our Pveg is lacking the upstream site to give a medium level of gene expression. It has been noted that the sporulation master regulatoion factor spoOA interacts with Pveg though it is not known how<cite>#3</cite>. The context with which we used the promoter Pveg is as a '''Polymerase Per Second''' (PoPS) generator. false true _199_ 0 2090 9 In stock false The biobrick part was designed to include a single binding site for the ''B.subtilis major sigma factor. In addition the biobrick standard was applied to the promoter Pveg sequence. false James Chappell annotation1975704 1 Sigma A-35 range1975704 1 63 68 annotation1975705 1 Sigma A -10 range1975705 1 86 91 BBa_K1364008 1 BBa_K1364008 Pveg - strong RBS - Antifungal GAFP-1 - Double terminator 2014-09-30T11:00:00Z 2015-06-08T09:17:49Z This part results from the association of BBa_K143012, BBa_K1364002 and BBa_B0015. The Gastrodia anti-fungal protein (GAFP-1) is a mannose-binding lectin which is able to inhibit the growth of multiples species of plant pathogenic fungi. false false _1740_ 4206 21466 9 It's complicated false This part is composed of the strong, constitutive promoter of Bacillus subtilis Pveg (K823003), strong RBS (K780002), the open reading frame of the Gastrodia anti-fungal protein 1 (GAFP-1) and a double terminator B0015. optimized for its expression and its secretion in Bacillus subtilis. The codon optimization was made thanks to the DNA 2.0 software program. false Laureen Mirassou component2391473 1 BBa_B0015 component2391466 1 BBa_K1364002 component2391461 1 BBa_K143012 annotation2391466 1 BBa_K1364002 range2391466 1 106 292 annotation2391461 1 BBa_K143012 range2391461 1 1 97 annotation2391473 1 BBa_B0015 range2391473 1 301 429 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K1364002 1 GAFP-1 RBS - Antifungal GAFP-1 2014-09-30T11:00:00Z 2015-06-08T08:39:49Z This gene was ordered from a synthesis company. The Gastrodia anti-fungal protein (GAFP-1) is a mannose-binding lectin which is able to inhibit the growth of multiples species of plant pathogenic fungi. The RBS used is a strong RBS for Bacillus subtilis (K780002). false false _1740_ 4206 21466 9 In stock false This part is composed of a Strong RBS (K780002) and the open reading frame of the Gastrodia anti-fungal protein 1 (GAFP-1) optimized for its expression and its secretion in Bacillus subtilis. The codon optimization was made thanks to the DNA 2.0 software program. false Manon Molina annotation2391443 1 GAFP-1 range2391443 1 140 187 annotation2391440 1 strong RBS K780002 range2391440 1 1 16 annotation2391442 1 Propeptide range2391442 1 98 139 annotation2391441 1 Signal peptide range2391441 1 17 97 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1364002_sequence 1 agagaacaaggaggggatgtttgcaaagagatttaagacgagtttacttccgctgtttgccggcttccttttgctgtttcaccttgtattagccggtcctgcggcagcaagtgcggaaacggctaacaaaagtaacgagctggatagcctttccttttcatataataatttcgaagaggacgattaa BBa_K1364008_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgttactagagagagaacaaggaggggatgtttgcaaagagatttaagacgagtttacttccgctgtttgccggcttccttttgctgtttcaccttgtattagccggtcctgcggcagcaagtgcggaaacggctaacaaaagtaacgagctggatagcctttccttttcatataataatttcgaagaggacgattaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K143012_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z