BBa_K1364003 1 D4E1 RBS - Antifungal D4E1 - Double terminator 2014-09-24T11:00:00Z 2016-02-03T10:04:36Z De Lucca AJ,??Bland JM,??Grimm C,??Jacks TJ,??Cary JW,??Jaynes JM,??Cleveland TE,??Walsh TJ. Fungicidal properties, sterol binding, and proteolytic resistance of the synthetic peptide D4E1. Can J Microbiol.??1998 Jun;44(6):514-20. D4E1 is a linear synthetic peptide of 17 amino acids which has shown to have antifungal activities by complexing with a sterol present in conidial wall of a variety of fungi. This part is composed of a RBS (K780002 spoVG), the open reading frame of D4E1 and a double terminator (B0015). This part was optimized for the expression and its secretion in Bacillus subtilis. false false _1740_ 4206 21465 9 In stock false The coding sequence of D4E1 is flanked on the N-terminal end with a signal peptide (amyE signal peptide) followed by a pro peptide, cleaved during the secretion process. false Jourdan Camille annotation2386386 1 D4E1 range2386386 1 140 192 annotation2386384 1 Signal Peptide range2386384 1 17 97 annotation2386387 1 BBa_B0015 range2386387 1 194 322 annotation2386383 1 BBa_K780002 strong RBS range2386383 1 1 16 annotation2386385 1 Pro Peptide range2386385 1 98 139 BBa_K823003 1 BBa_K823003 P<sub>veg</sub> 2012-07-15T11:00:00Z 2015-05-08T01:13:29Z Bacillus subtilis Released HQ 2013 Pveg is a strong, constitutive promoter of Bacillus subtilis false false _1081_ 0 12081 9 In stock false no considerations false Korinna Kraft annotation2190180 1 promoter range2190180 1 1 237 BBa_K1364009 1 D4E1 Pveg - RBS - Antifungal D4E1 - Double Terminator 2014-09-24T11:00:00Z 2015-06-08T08:36:05Z De Lucca AJ,??Bland JM,??Grimm C,??Jacks TJ,??Cary JW,??Jaynes JM,??Cleveland TE,??Walsh TJ. Fungicidal properties, sterol binding, and proteolytic resistance of the synthetic peptide D4E1. Can J Microbiol.??1998 Jun;44(6):514-20. This expression cassette is designed for the expression of an antifugal peptide, D4E1, and for its secretion in Bacillus subtilis. D4E1 has shown antifungal activity by complexing with a streol present in condinia's wall of a variety of fungi. It is composed of a constituve promoter (K143012 Pveg), a RBS (K780002 strong RBS), the open reading frame of D4E1 and a double terminator (B0015). false false _1740_ 4206 21465 9 In stock true The coding sequence of D4E1 is flanked on the N-terminal end with a signal peptide (amyE signal peptide) followed by a pro peptide, cleaved during the secretion process. false Jourdan Camille component2386389 1 BBa_K823003 component2386395 1 BBa_K1364003 annotation2386395 1 BBa_K1364003 range2386395 1 246 567 annotation2386389 1 BBa_K823003 range2386389 1 1 237 BBa_K1364003_sequence 1 agagaacaaggaggggatgtttgcaaagagatttaagacgagtttacttccgctgtttgccggcttccttttgctgtttcaccttgtattagccggtcctgcggcagcaagtgcggaaacggctaacaaaagtaacgagttcaagttacgggcgaaaatcaaagtacggctgcgggcgaagatcaagctatgaccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K823003_sequence 1 ggagttctgagaattggtatgccttataagtccaattaacagttgaaaacctgcataggagagctatgcgggttttttattttacataatgatacataatttaccgaaacttgcggaacataattgaggaatcatagaattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtagt BBa_K1364009_sequence 1 ggagttctgagaattggtatgccttataagtccaattaacagttgaaaacctgcataggagagctatgcgggttttttattttacataatgatacataatttaccgaaacttgcggaacataattgaggaatcatagaattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtagttactagagagagaacaaggaggggatgtttgcaaagagatttaagacgagtttacttccgctgtttgccggcttccttttgctgtttcaccttgtattagccggtcctgcggcagcaagtgcggaaacggctaacaaaagtaacgagttcaagttacgggcgaaaatcaaagtacggctgcgggcgaagatcaagctatgaccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z