BBa_K143021 1 RBS-spoVG SpoVG ribosome binding site (RBS) for B. subtilis 2008-09-16T11:00:00Z 2015-05-08T01:10:23Z The sequence was taken from a previous research paper [1] and was constructed by Geneart. Released HQ 2013 Description: SpoVG is an endogenous ribosome binding site from B.subtilis. The sequence of the spoVG ribosome binding site is AAAGGUGGUGA which is complementary to the sequence UUUCCUCCACU from the 3' region of the 16s rRNA from B.subtilis. Previous research showed that the predicted binding energy of the 16s rRNA to the RBS is -19kcal <cite>1</cite> false true _199_ 0 2090 9 In stock false In order to ensure that the RBS is functional the actual ribosome binding site was maintained and the distance between the RBS and the start codon maintained. In order to conform to the biobrick standard the sequence flanking the RBS had to be changed but the distance between the promoter and RBS, and start codon and RBS was maintained. false James Chappell annotation1975997 1 rbs range1975997 1 1 12 BBa_K733013 1 BBa_K733013 <i>Pveg</i>+R.B.S. 2012-09-15T11:00:00Z 2015-05-08T01:13:06Z Not available at this moment. Released HQ 2013 Not available at this moment. false false _979_ 0 12444 9 In stock false Not available at this moment. false Chris, Yu lai cheong component2183796 1 BBa_K143021 component2183794 1 BBa_K316001 annotation2183796 1 BBa_K143021 range2183796 1 98 109 annotation2183794 1 BBa_K316001 range2183794 1 1 97 BBa_K1364010 1 BBa_K1364010 Pveg-SpoVG + EcAMP-1 2014-10-02T11:00:00Z 2015-06-08T09:18:13Z bla bla false false _1740_ 4206 21465 9 It's complicated false bla false Jourdan Camille component2392882 1 BBa_K1162001 component2392879 1 BBa_K733013 annotation2392882 1 BBa_K1162001 range2392882 1 116 229 annotation2392879 1 BBa_K733013 range2392879 1 1 109 BBa_K1162001 1 BBa_K1162001 EcAMP-1 antimicrobial peptide from barnyard grass (<i>Echinochloa crus-galli</i>) 2013-09-14T11:00:00Z 2016-01-28T12:12:04Z Echinochloa crus-galli seeds. RFC 23 compatible. Contains ATG (methionine). false false _1474_ 4206 10131 9 In stock false Codon optimized for E. Coli, contains ATG (met). false Charles Barentine annotation2343326 1 Met range2343326 1 1 3 annotation2365787 1 EcAMP-1 range2365787 1 4 114 BBa_K316001 1 Pveg pVeg Constitutive promoter for Veg locus from B. subtilis 2010-10-11T11:00:00Z 2015-05-08T01:11:56Z PCR from existing biobrick K143053 using Pfu polymerase II Released HQ 2013 This part is identical to the sequence submitted by Imperial 2008 team, this part was produced from K143053 by PCR. PVeg is a constitutive promoter controlled by Sigma factor A. This promoter has two binding sites which leads to high expression of downstream genes. There is some evidence that the sporulation master regulator the spoOA can interact with pVeg although the mechanism is not known. false false _440_ 0 7480 9 In stock false PCR using Pfu polymerase to avoid mutations false IC 2010 Team annotation2085549 1 Sigma A-35 range2085549 1 63 68 annotation2085550 1 Sigma A-35 range2085550 1 86 91 BBa_K316001_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgt BBa_K143021_sequence 1 aaaggtggtgaa BBa_K1364010_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtaaaggtggtgaatactagatgggtagcggtcgtggtagctgtcgtagccagtgtatgcgtcgtcatgaagatgaaccgtggcgtgttcaagaatgtgttagccagtgccgtcgtcgtcgcggtggtggtgat BBa_K733013_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtaaaggtggtgaa BBa_K1162001_sequence 1 atgggtagcggtcgtggtagctgtcgtagccagtgtatgcgtcgtcatgaagatgaaccgtggcgtgttcaagaatgtgttagccagtgccgtcgtcgtcgcggtggtggtgat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z