BBa_K1364003 1 D4E1 RBS - Antifungal D4E1 - Double terminator 2014-09-24T11:00:00Z 2016-02-03T10:04:36Z De Lucca AJ,??Bland JM,??Grimm C,??Jacks TJ,??Cary JW,??Jaynes JM,??Cleveland TE,??Walsh TJ. Fungicidal properties, sterol binding, and proteolytic resistance of the synthetic peptide D4E1. Can J Microbiol.??1998 Jun;44(6):514-20. D4E1 is a linear synthetic peptide of 17 amino acids which has shown to have antifungal activities by complexing with a sterol present in conidial wall of a variety of fungi. This part is composed of a RBS (K780002 spoVG), the open reading frame of D4E1 and a double terminator (B0015). This part was optimized for the expression and its secretion in Bacillus subtilis. false false _1740_ 4206 21465 9 In stock false The coding sequence of D4E1 is flanked on the N-terminal end with a signal peptide (amyE signal peptide) followed by a pro peptide, cleaved during the secretion process. false Jourdan Camille annotation2386386 1 D4E1 range2386386 1 140 192 annotation2386387 1 BBa_B0015 range2386387 1 194 322 annotation2386384 1 Signal Peptide range2386384 1 17 97 annotation2386383 1 BBa_K780002 strong RBS range2386383 1 1 16 annotation2386385 1 Pro Peptide range2386385 1 98 139 BBa_K823003 1 BBa_K823003 P_veg 2012-07-15T11:00:00Z 2015-05-08T01:13:29Z Bacillus subtilis Released HQ 2013 Pveg is a strong, constitutive promoter of Bacillus subtilis false false _1081_ 0 12081 9 In stock false no considerations false Korinna Kraft annotation2190180 1 promoter range2190180 1 1 237 BBa_K1364013 1 BBa_K1364013 Pveg - RBS - Antifungal GAFP-1 - RBS - Antifungal D4E1 - Double terminator 2014-09-30T11:00:00Z 2015-06-08T08:36:54Z This part results from the association of BBa_K823003, BBa_K1364002 and BBa_K1364003. The Gastrodia anti-fungal protein (GAFP-1) is a mannose-binding lectin which is able to inhibit the growth of multiples species of plant pathogenic fungi. D4E1 is a linear synthetic peptide of 17 amino acids which has shown to have antifungal activities by complexing with a sterol present in conidia's wall of a variety of fungi. The RBS used is a strong RBS for Bacillus subtilis (K780002). false false _1740_ 4206 21466 9 It's complicated true This part is designed for the co-expression of two different peptides with anti-fungal activities : D4E1 and GAFP-1. It is composed of the strong, constitutive promotor of B. subtilis Pveg (K823003) and the translation unit with GAFP-1 and D4E1 (BBa_K1364012). http://2014.igem.org/wiki/images/4/40/BBa_K1364013.png false Aur??lie Kanitzer component2391501 1 BBa_K1364002 component2391496 1 BBa_K823003 component2391507 1 BBa_K1364003 annotation2391507 1 BBa_K1364003 range2391507 1 441 762 annotation2391501 1 BBa_K1364002 range2391501 1 246 432 annotation2391496 1 BBa_K823003 range2391496 1 1 237 BBa_K1364002 1 GAFP-1 RBS - Antifungal GAFP-1 2014-09-30T11:00:00Z 2015-06-08T08:39:49Z This gene was ordered from a synthesis company. The Gastrodia anti-fungal protein (GAFP-1) is a mannose-binding lectin which is able to inhibit the growth of multiples species of plant pathogenic fungi. The RBS used is a strong RBS for Bacillus subtilis (K780002). false false _1740_ 4206 21466 9 In stock false This part is composed of a Strong RBS (K780002) and the open reading frame of the Gastrodia anti-fungal protein 1 (GAFP-1) optimized for its expression and its secretion in Bacillus subtilis. The codon optimization was made thanks to the DNA 2.0 software program. false Manon Molina annotation2391441 1 Signal peptide range2391441 1 17 97 annotation2391440 1 strong RBS K780002 range2391440 1 1 16 annotation2391443 1 GAFP-1 range2391443 1 140 187 annotation2391442 1 Propeptide range2391442 1 98 139 BBa_K1364003_sequence 1 agagaacaaggaggggatgtttgcaaagagatttaagacgagtttacttccgctgtttgccggcttccttttgctgtttcaccttgtattagccggtcctgcggcagcaagtgcggaaacggctaacaaaagtaacgagttcaagttacgggcgaaaatcaaagtacggctgcgggcgaagatcaagctatgaccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K823003_sequence 1 ggagttctgagaattggtatgccttataagtccaattaacagttgaaaacctgcataggagagctatgcgggttttttattttacataatgatacataatttaccgaaacttgcggaacataattgaggaatcatagaattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtagt BBa_K1364002_sequence 1 agagaacaaggaggggatgtttgcaaagagatttaagacgagtttacttccgctgtttgccggcttccttttgctgtttcaccttgtattagccggtcctgcggcagcaagtgcggaaacggctaacaaaagtaacgagctggatagcctttccttttcatataataatttcgaagaggacgattaa BBa_K1364013_sequence 1 ggagttctgagaattggtatgccttataagtccaattaacagttgaaaacctgcataggagagctatgcgggttttttattttacataatgatacataatttaccgaaacttgcggaacataattgaggaatcatagaattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtagttactagagagagaacaaggaggggatgtttgcaaagagatttaagacgagtttacttccgctgtttgccggcttccttttgctgtttcaccttgtattagccggtcctgcggcagcaagtgcggaaacggctaacaaaagtaacgagctggatagcctttccttttcatataataatttcgaagaggacgattaatactagagagagaacaaggaggggatgtttgcaaagagatttaagacgagtttacttccgctgtttgccggcttccttttgctgtttcaccttgtattagccggtcctgcggcagcaagtgcggaaacggctaacaaaagtaacgagttcaagttacgggcgaaaatcaaagtacggctgcgggcgaagatcaagctatgaccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z