BBa_K1365000 1 BBa_K1365000 NisA 2014-09-22T11:00:00Z 2015-05-08T01:10:07Z Obtained by PCR on the genome of L. lactis NZ9700, a nisin producing strain. NisA codes for the nisin precursor. Together with the genes NisB, NisT, NisC, NisP, NisR and NisK it is responsible for producing the lantibiotic nisin in Lactococcus lactis. Can be used in the Lactococcus lactis NZ9800, a strain with a deletion in the original NisA gene, to let it produce nisin. false false _1741_ 0 23000 9 In stock false - false Sandra Mous annotation2385399 1 NisA range2385399 1 1 174 annotation2385398 1 stop range2385398 1 172 174 annotation2385397 1 start range2385397 1 1 3 BBa_K1365000_sequence 1 atgagtacaaaagattttaacttggatttggtatctgtttcgaagaaagattcaggtgcatcaccacgcattacaagtatttcgctatgtacacccggttgtaaaacaggagctctgatgggttgtaacatgaaaacagcaacttgtcattgtagtattcacgtaagcaaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z