BBa_K1365009 1 BBa_K1365009 PNisI with RBS 2014-09-23T11:00:00Z 2015-05-08T01:10:07Z Obtained by PCR on the genome of Lactococcus lactis NZ9700, a nisin producing strain. Promoter with Original RBS from Lactococcus lactis NZ9700. Activated by NisR. Normally placed in front of the NisA gene, for regulating transcription of the nisin precursor. false false _1741_ 0 23000 9 Not in stock false Used primers: forward - 5'-GTTTCTTCGAATTCGCGGCCGCTTCTAGAGAGCACTGGATAATGACTATT-3' reverse - 5'-TACTAGTAGCGGCCGCTGCAGGAAGAAACTTCCTCTTCCCTCCTTTCAA-3' to PCR PNisI from the genome and add the BioBrick prefix and suffix. false Sandra Mous BBa_K1365009_sequence 1 agcactggataatgactattttgtagataaagcagaaaaaatattagagtcagctatgcaaaggaaacttggtattgattcatatatgatttgccatggctattctggtttaatagaaatttgttctttatttaagcggctattaaatacaaaaaagtttgattcatacatggaagaatttaatgttaatagtgagcaaattcttgaagaatacggagatgaaagtggcacgggttttcttgaaggaataagtggctgtatactggtattatcgaaatttgaatattcaatcaattttacttattggagacaagcactgttactttttgacgattttttgaaaggagggaagaggaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z