BBa_K1366109 1 BBa_K1366109 pep42 peptide 2014-10-09T11:00:00Z 2015-05-08T01:10:08Z We used the DNA sequence of the PIII protein that is reported in NCBI This part allows the production of a recombinant pIII protein linked with a pep42 peptide. This peptide change the tropism of the virus M13 and enables it to bind to a receptor called GRP78 that it is highly present in cancer cells. The binding between pep42 and GRP78 receptor allows the bacteriophage to penetrate the cancer cells and this initiates the transfection of DNA mediated with bacteriophages. false false _1743_ 0 16721 9 It's complicated false The structure of this construct is pIII linked with a pep42 peptide false Eduardo Cepeda Ca??edo, Mercedes Alejandra Vazquez Cantu annotation2415794 1 pep42 range2415794 1 1 81 BBa_K1366109_sequence 1 atgtaccgttgcgctgccgggcggttatgtgcgtgtttgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z