BBa_K1367004 1 BBa_K1367004 siRNA for LAR ( leucoanthocyanidin reductase) gene in Camelia sinensis 2014-10-08T11:00:00Z 2015-05-08T01:10:08Z This part come from synthesize DNA from IDT. This part containing siRNA LAR (leucoanthocyanidin reductase) gene. The function of this part is to knockdown LAR gene in Camelia sinensis (Tea plant) that producing non-EGCG gene. To use this part, we should adding promoter at this part and to know the performance, it can be checking use gene target siRNA LAR. We should transform this part into the mamalian cell so this part will be working. false false _1744_ 0 21723 9 It's complicated false this part was design using bioinformatics tool and we synthesize it so it can be useful part. false Galuh Wening Permatasari BBa_K1367004_sequence 1 acctttgtgacgggtcttagtatgtgacaggaagcatactaagacccgtcacaaaggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z