BBa_K1367005 1 BBa_K1367005 siRNA GFP 2014-10-08T11:00:00Z 2015-05-08T01:10:08Z this part come from synthesize by IDT siRNA GFP used for positive control in this project. to use this part, react with the negative control (plasmid that contain GFP). false false _1744_ 0 21723 9 It's complicated false this part use for positive control and to check the performance of GFP. false Galuh Wening Permatasari BBa_K1367005_sequence 1 agatctcgtggtagaagaagttcctcactgtccttcgaggaacttcttctaccacgcttaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z