BBa_J01010 1 Lock 1 Riboregulator Lock 1 2005-11-05T12:00:00Z 2015-08-31T04:08:12Z Biobricked version of Isaacs' riboregulator cis repressed lock, crR12. false false _13_ 0 395 13 In stock false false Golden Bear BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_J01008 1 Key 1 Riboregulator key 1 2005-11-05T12:00:00Z 2015-08-31T04:08:12Z Released HQ 2013 Biobricked version of Isaacs' riboregulator trans activating key, taR12 false true _13_ 0 395 13 In stock false false Golden Bear BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K773003 1 BBa_K773003 mCherry-LVA 2012-09-30T11:00:00Z 2015-05-08T01:13:15Z This part was modified from a plasmid provided by the Murray lab at Caltech. Released HQ 2013 This part contains the fluorescent protein mCherry attached to a degradation tag. It will decrease the amount of fluorescent protein over time. false false _1025_ 0 11646 9 In stock false We modified the AAV sequence to LVA with PCR. false Katie Knister annotation2209511 1 ssrA degradation tag: LVA range2209511 1 730 759 annotation2209510 1 Start range2209510 1 19 21 annotation2209512 1 Stop range2209512 1 760 762 annotation2209508 1 B0034 range2209508 1 1 12 annotation2209509 1 mCherry-LVA range2209509 1 19 765 annotation2209513 1 Stop range2209513 1 763 765 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_R0062 1 lux pR Promoter (luxR & HSL regulated -- lux pR) 2003-01-31T12:00:00Z 2015-05-08T01:14:15Z <em>V. fischeri</em> Released HQ 2013 Promoter activated by LuxR in concert with HSL</p> <p>The lux cassette of V. fischeri contains a left and a right promoter. The right promoter gives weak constitutive expression of downstream genes.This expression is up-regulated by the action of the LuxR activator protein complexed with the autoinducer, 3-oxo-hexanoyl-HSL. Two molecules of LuxR protein form a complex with two molecules of the signalling compound homoserine lactone (HSL). This complex binds to a palindromic site on the promoter, increasing the rate of transcription. false true _1_ 0 24 7 In stock false <P> <P>This promoter is based on the <em>Vibrio fischeri </em>quorum sensing gene promoters. Two genes LuxI and LuxR and transcribed in opposite directions as shown below. The original sequence from which the parts <bb_part>BBa_R0062</bb_part> and <bb_part>BBa_R0063</bb_part> were derived is shown in the picture below. <p><img src="<bb_file>Image1.gif</bb_file>" width="614" height="362"><P> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation2046 1 -35 range2046 1 20 25 annotation7070 1 BBa_R0062 range7070 1 1 55 annotation2048 1 start range2048 1 53 53 annotation2047 1 -10 range2047 1 42 47 annotation2045 1 LuxR/HSL range2045 1 1 20 BBa_I714075 1 BBa_I714075 [J01008][B0015] ([Key1][Double Terminator]) 2007-10-21T11:00:00Z 2015-08-31T04:07:48Z [J01008] + [B0015] Released HQ 2013 This is J01008(key 1) with B0015 double terminator in the end. false false _142_ 0 2248 9 In stock false false Mingzhi Qu component1952132 1 BBa_B0012 component1952130 1 BBa_B0010 component1952129 1 BBa_J01008 annotation1952130 1 BBa_B0010 range1952130 1 103 182 annotation1952132 1 BBa_B0012 range1952132 1 191 231 annotation1952129 1 BBa_J01008 range1952129 1 1 94 BBa_K1368008 1 BBa_K1368008 mcherry generator driven by HSL under the post transcriptional control 2014-09-29T11:00:00Z 2015-05-08T01:10:08Z to be finished to be finished false false _1745_ 0 22423 9 Not in stock false to be finished false Yihui Zheng component2390540 1 BBa_B0015 component2390533 1 BBa_K773003 component2390508 1 BBa_R0062 component2390520 1 BBa_I714075 component2390526 1 BBa_J01010 component2390522 1 BBa_R0062 annotation2390520 1 BBa_I714075 range2390520 1 64 294 annotation2390522 1 BBa_R0062 range2390522 1 303 357 annotation2390540 1 BBa_B0015 range2390540 1 1187 1315 annotation2390526 1 BBa_J01010 range2390526 1 366 405 annotation2390533 1 BBa_K773003 range2390533 1 414 1178 annotation2390508 1 BBa_R0062 range2390508 1 1 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0062_sequence 1 acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa BBa_K773003_sequence 1 aaagaggagaaatactagatggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccttgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaaggcagcaaacgacgaaaactacgctctagtagcttaataa BBa_J01008_sequence 1 acccaaatccaggaggtgaatctagtaggtggttaatgaaaattaacttacttactagaaatatctctaaaaagccagattattaatccggctt BBa_I714075_sequence 1 acccaaatccaggaggtgaatctagtaggtggttaatgaaaattaacttacttactagaaatatctctaaaaagccagattattaatccggctttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J01010_sequence 1 aactagaatcacctcttggatttgggtattaaagaggaga BBa_K1368008_sequence 1 acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaatactagagacccaaatccaggaggtgaatctagtaggtggttaatgaaaattaacttacttactagaaatatctctaaaaagccagattattaatccggctttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaatactagagaactagaatcacctcttggatttgggtattaaagaggagatactagagaaagaggagaaatactagatggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccttgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaaggcagcaaacgacgaaaactacgctctagtagcttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z