BBa_K1369000 1 BBa_K1369000 Repressor-Repressor promoter (TetR and LacI operator sites) 2014-08-17T11:00:00Z 2015-05-08T01:10:08Z This part is taken from the paper "Programming gene expression with combinatorial promoters," by Robert Sidney Cox III et al. This is a repressor-repressor (RR) combinatorial promoter which consists of a LacI operator site upstream of the -35 RNA polymerase binding site, and a TetR operator site within the -35 and -10 RNA polymerase boxes. false false _1746_ 0 20314 9 It's complicated false To test the logic of this RR promoter, we assembled constructs containing the promoter, a bicistronic RBS (part BBa_J119024), and GFP, in that order, downstream of the promoter. false annotation2381235 1 LacI operator site range2381235 1 70 102 annotation2381237 1 -35 RNA polymerase box range2381237 1 40 45 annotation2381238 1 -10 RNA polymerase box range2381238 1 63 68 annotation2381236 1 TetR operator site range2381236 1 45 67 BBa_K1369000_sequence 1 tacaacgtcgtgttagctgcctttcgtcttcaataattcttgacatccctatcagtgatagagatactttgtggaattgtgagcggataacatttcacacag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z