BBa_K1369001 1 BBa_K1369001 Repressor-Repressor promoter (LacI and TetR operator sites) 2014-08-17T11:00:00Z 2015-05-08T01:10:08Z This part is taken from the paper "Programming gene expression with combinatorial promoters," by Robert Sidney Cox III et al. This is a repressor-repressor (RR) combinatorial promoter which consists of a TetR operator site within the -35 and -10 RNA polymerase boxes and a LacI operator site downstream of the -10 RNA polymerase box. false false _1746_ 0 20314 9 Not in stock false To test the logic of this RR promoter, we assembled constructs containing the promoter, a bicistronic RBS (part BBa_J119024), and GFP, in that order, downstream of the promoter. false annotation2381240 1 -35 RNA polymerase box range2381240 1 39 43 annotation2381239 1 LacI operator site range2381239 1 1 42 annotation2381241 1 -10 RNA polymerase box range2381241 1 62 66 annotation2381242 1 TetR operator site range2381242 1 45 66 BBa_K1369001_sequence 1 tacaacgtctgttagctgcaattgtgagcggataacaattgacaaataactctatcaatgatagagttcgttatcaccgccaggggtaaggcgttacccaac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z