BBa_K137030 1 BBa_K137030 constitutive promoter with (TA)9 between -10 and -35 elements 2008-07-20T11:00:00Z 2015-05-08T01:10:09Z This part was PCR amplified from two synthesized primers that bound to each other. constitutive promoter with (TA)9 between -10 and -35 elements false false _187_ 0 3112 9 It's complicated false With 9 TA repeats between the -10 and -35 elements, the distance between the two elements is not optimal for the sigma factor to bind to the promoter. Thus, the promoter should be in the 'off' state. false Allen Lin annotation1967766 1 -10 element range1967766 1 21 25 annotation1967767 1 TA repeat range1967767 1 7 20 BBa_K137030_sequence 1 tttaattatatatatatatatataatggaagcgtttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z