BBa_K137046 1 BBa_K137046 150 bp inverted tetR promoter 2008-07-20T11:00:00Z 2015-05-08T01:10:09Z Primers were synthesized to bind to part Q04400, and then a PCR reaction was run. tetR promoter with noncoding, spacer DNA upstream of it to make the total length 150 bp false false _187_ 0 3112 9 It's complicated false This part is in a series of tetR promoter that have total lengths of 150, 250, 350, 450, 650, and 850 bp. We chose the region upstream of tetR in part Q04400 to be the noncoding DNA segment. This noncoding segment consists of the 3' end of tetR and B0015. None of the parts in this series was long enough to include the start codon of tetR, so a functional tetR protein should not be transcribed. false Allen Lin annotation1968019 1 tetR promoter range1968019 1 1 54 BBa_K137046_sequence 1 gtgctcagtatctctatcactgatagggatgtcaatctctatcactgatagggactctagtatataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z