BBa_K137049 1 BBa_K137049 450 bp inverted tetR promoter 2008-07-20T11:00:00Z 2015-05-08T01:10:09Z Primers were synthesized to bind to part Q04400, and then a PCR reaction was run. Inverted tetR promoter with noncoding, spacer DNA upstream of it to make the total length 450 bp. false false _187_ 0 3112 9 It's complicated false This part is in a series of inverted tetR promoters that have total lengths of 150, 250, 350, 450, 650, and 850 bp. We chose the region upstream of tetR in part Q04400 to be the noncoding DNA segment. This noncoding segment consists of the 3' end of tetR and B0015. None of the parts in this series was long enough to include the start codon of tetR, so a functional tetR protein should not be transcribed. false Allen Lin annotation1968022 1 tetR promotoer range1968022 1 1 54 BBa_K137049_sequence 1 gtgctcagtatctctatcactgatagggatgtcaatctctatcactgatagggactctagtatataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctggctctagtagtgatctacactagcactatcagtgttattaagctactaaagcgtagttttcgtcgtttgcagcggacccactttcacatttaagttgtttttctaatccgcatatgatcaattcaaggccgaataagaaggctggctctgcaccttggtgatcaaataattcgatagcttgtcgtaataatggcggcatactatcagtagtaggtgtttccctttcttctttagcgacttgatgctcttgatcttccaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z