BBa_K137053 1 BBa_K137053 Constitutive folB expression construct 2008-07-27T11:00:00Z 2015-05-08T01:10:09Z The original folB gene was extracted from the Lactoccocus lactis subspe. IL1403 genome (ordered from ATCC). Released HQ 2013 This is the folate synthesis gene folB, one of five genes involved in the folate synthesis operon. In this construct, folB has been inserted behind the strong promoter j23100, the strong RBS b0034, and in front of the double terminator B0015. The vector is the inducible copy plasmid psB2K3, which can be induced to high copy via IPTG. The purpose of this construct is to test the effects of folB (dihydroneopterin aldolase) overexpression on total folate production in Escherichia coli, with the goal of increasing total folate production. false true _187_ 0 2987 9 In stock true We had originally planned on overexpressing the entire folate operon, as well as the individual gene components of the operon. However, we were unable to clone the operon out of the genome successfully. true Victoria Hsiao component1969095 1 BBa_B0010 component1969093 1 BBa_B0034 component1969094 1 BBa_K137009 component1969097 1 BBa_B0012 component1969091 1 BBa_J23100 annotation1969093 1 BBa_B0034 range1969093 1 44 55 annotation1969091 1 BBa_J23100 range1969091 1 1 35 annotation1969094 1 BBa_K137009 range1969094 1 62 415 annotation1969097 1 BBa_B0012 range1969097 1 512 552 annotation1969095 1 BBa_B0010 range1969095 1 424 503 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K137009 1 folB folB (dihydroneopterin aldolase) 2008-06-19T11:00:00Z 2015-05-08T01:10:08Z L.lactis folB is part of the L.lactis folate gene cluster. false false _187_ 0 2987 9 It's complicated false We were unsure of whether or not the L.lactis RBS would work with E. coli and so we are going to try cloning the entire gene cluster with the RBSs as well as cloning out each gene separately and adding E.coli RBSs. false Victoria Hsiao BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_B0034_sequence 1 aaagaggagaaa BBa_K137009_sequence 1 atgtacaaaataaaacttaataatatgaaatttagagcacatattggtgttctgccagaagaaaaagttctcggacaaaatctcgaaattgatttaatcgtggaaacaaattttgatttttcaggaaaagacgaattagatgaaactttgtcttatgttgatttctatgaggcaacaaaagcagttgtagaatcttcaaaagctgatttaattgaacatgttgcctttgaaattattcaagcagtaaaggctacttcagagcgtatatcaacggttgaagtccatcttagaaaattagccgtaccgattgaaggaatttttgattcagctgaaatcgagatgagagggtaataa BBa_K137053_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaatactagatgtacaaaataaaacttaataatatgaaatttagagcacatattggtgttctgccagaagaaaaagttctcggacaaaatctcgaaattgatttaatcgtggaaacaaattttgatttttcaggaaaagacgaattagatgaaactttgtcttatgttgatttctatgaggcaacaaaagcagttgtagaatcttcaaaagctgatttaattgaacatgttgcctttgaaattattcaagcagtaaaggctacttcagagcgtatatcaacggttgaagtccatcttagaaaattagccgtaccgattgaaggaatttttgattcagctgaaatcgagatgagagggtaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z