BBa_K137054 1 folKE + b0 Constitutive folKE expression construct 2008-07-27T11:00:00Z 2015-05-08T01:10:09Z The original folKE gene was extracted from the L.lactis subspe. IL1403 genome. Released HQ 2013 This is the folate synthesis gene folKE, one of five genes (folB, folKE, folP, folC, folA) involved in the folate synthesis operon. In this construct, folKE has been inserted behind the strong promoter j23100, the strong RBS b0034, and in front of the double terminator B0015. The vector is the inducible copy plasmid psB2K3, which can be induced to high copy via IPTG. The purpose of this construct is to test the effects of folKE (a fusion gene for GTP cyclohydrolase I (folE) + 2-amino-4-hydroxy-6- hydroxymethyldihydropteridine pyrophosphokinase (folK)) overexpression on total folate production in Escherichia coli, with the goal of increasing total folate production. false false _187_ 0 2987 9 In stock true FolKE has been shown to be a good target for metabolically engineering the overexpression of folate in bacteria, particularly in L.lactis. One possible explanation for this is that since GTP cyclohydrolase I is involved in the first enzymatic step in the folate biosynthesis pathway, overexpression of this enzyme will increase the total flux through the pathway. true Victoria Hsiao component1969104 1 BBa_K137011 component1969103 1 BBa_B0034 component1969105 1 BBa_B0010 component1969107 1 BBa_B0012 component1969101 1 BBa_J23100 annotation1969104 1 BBa_K137011 range1969104 1 62 1114 annotation1969101 1 BBa_J23100 range1969101 1 1 35 annotation1969105 1 BBa_B0010 range1969105 1 1123 1202 annotation1969107 1 BBa_B0012 range1969107 1 1211 1251 annotation1969103 1 BBa_B0034 range1969103 1 44 55 BBa_K137011 1 folKE folKE (GTP Cyclohydrolase I + pyrophosphokinase) 2008-06-19T11:00:00Z 2015-05-08T01:10:08Z L.lactis genome folKE is a bifunctional gene which encodes two necessary enzymes for folate biosynthesis (2-Amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase / GTP cyclohydrolase I). false false _187_ 0 2987 9 It's complicated false We were unsure of whether or not the L.lactis RBS would work with E. coli and so we are going to try cloning the entire gene cluster with the RBSs as well as cloning out each gene separately and adding E.coli RBSs. false Victoria Hsiao BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_B0034_sequence 1 aaagaggagaaa BBa_K137054_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaatactagatgcaaacaacttatttaagcatgggaagtaatattggtgaccgtcagtattatttacatgaagccattcgtttattgggaaaacaccctaaaattatgattgaaaaagtatcaaatttttatgaaagtactccagtcggcggcgtcaaacaagatgattttactaatttggcattaaaggtggcaacgctacttgaacctttggaattattatcttttattcatgaagttgagctatctttgaaccgtgagcgaaaaattcattgggggccaagaacaattgatattgatattattttctataacgacttagaaatgcaagaagaaaacttggttattccacataaagaagcttttaatcgtctttttgtcttgaaacctatttttgaacttattgataaagactttaaatattatgcgtcaatagaaaaagcaatagccgaactttcagtaagtgaacaagagctccatgtgataaaagaagaaaaaacaccaagaaatcgtattgaagatgctgttaaagagattctctttgcagtaggtgaaaatccaaatcgagaaggattacttgaaactccagcgagagtagctaaaatgtatgaagaaattctttcgtcacaacgcttaagcaagtttaatgagtataaactttttgaaattgattcttctaaaacggattcaatcgtgttgattaaagatattcctttttattcaatgtgtgagcatcatatgttaccattttttgggaaagctcatgttgcctatattccagctgatggaaaaattattggcttgtcaaaaattccccgtttagttgattatgtttcgcgcaaactctcagttcaagaaaatatcactcatgatattggagatgttttgactgatattttgaatcctaaaggagtggcagttcttgttgaaggacgtcatatgtgcgttgaaatgcgtggagtaaaaaaagtaaattctattactaaaacttcttattttttaggtgaatttaaagaaaataatgaaaaaagaatggaatttttagaaagtcttttataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K137011_sequence 1 atgcaaacaacttatttaagcatgggaagtaatattggtgaccgtcagtattatttacatgaagccattcgtttattgggaaaacaccctaaaattatgattgaaaaagtatcaaatttttatgaaagtactccagtcggcggcgtcaaacaagatgattttactaatttggcattaaaggtggcaacgctacttgaacctttggaattattatcttttattcatgaagttgagctatctttgaaccgtgagcgaaaaattcattgggggccaagaacaattgatattgatattattttctataacgacttagaaatgcaagaagaaaacttggttattccacataaagaagcttttaatcgtctttttgtcttgaaacctatttttgaacttattgataaagactttaaatattatgcgtcaatagaaaaagcaatagccgaactttcagtaagtgaacaagagctccatgtgataaaagaagaaaaaacaccaagaaatcgtattgaagatgctgttaaagagattctctttgcagtaggtgaaaatccaaatcgagaaggattacttgaaactccagcgagagtagctaaaatgtatgaagaaattctttcgtcacaacgcttaagcaagtttaatgagtataaactttttgaaattgattcttctaaaacggattcaatcgtgttgattaaagatattcctttttattcaatgtgtgagcatcatatgttaccattttttgggaaagctcatgttgcctatattccagctgatggaaaaattattggcttgtcaaaaattccccgtttagttgattatgtttcgcgcaaactctcagttcaagaaaatatcactcatgatattggagatgttttgactgatattttgaatcctaaaggagtggcagttcttgttgaaggacgtcatatgtgcgttgaaatgcgtggagtaaaaaaagtaaattctattactaaaacttcttattttttaggtgaatttaaagaaaataatgaaaaaagaatggaatttttagaaagtcttttataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z