BBa_K137070 1 BBa_K137070 fimE Junction (IRL + IRR) 2008-08-07T11:00:00Z 2015-05-08T01:10:09Z Previously constructed biobrick parts fimE Junction (IRL + IRR) false false _187_ 0 3112 9 It's complicated false None false Allen Lin component1970332 1 BBa_K137008 component1970329 1 BBa_K137010 annotation1970332 1 BBa_K137008 range1970332 1 44 78 annotation1970329 1 BBa_K137010 range1970329 1 1 35 BBa_K137008 1 IRR fimE IRR 2008-06-19T11:00:00Z 2015-05-08T01:10:08Z pFIP plasmid fimE inverted repeat right recombination site false false _187_ 0 3112 9 It's complicated false none false Allen Lin annotation1963842 1 IRR in range1963842 1 19 35 annotation1963841 1 IRR out range1963841 1 1 17 BBa_K137010 1 fimE IRL fimE IRL 2008-06-19T11:00:00Z 2015-05-08T01:10:08Z pFIP plasmid fimE inverted repeat left recombination site false false _187_ 0 3112 9 It's complicated false none false Allen Lin annotation1963844 1 IRL out range1963844 1 19 35 annotation1963843 1 IRL in range1963843 1 1 17 BBa_K137010_sequence 1 tctatgagtcaaaatggccccaattgtcttgtatt BBa_K137008_sequence 1 aagatgaaacatttggggccaaactgtccatatta BBa_K137070_sequence 1 tctatgagtcaaaatggccccaattgtcttgtatttactagagaagatgaaacatttggggccaaactgtccatatta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z