BBa_K137071 1 BBa_K137071 113 non-coding spacer part 2008-08-07T11:00:00Z 2015-05-08T01:10:09Z PCR with synthesized primers off BioBrick part Q04400. 121 non-coding spacer part taken from the tail portion of tetR in Q04400. false false _187_ 0 3112 9 Not in stock false Since this DNA segment is a portion of tetR, this segment should not code for a protein and should not have a regulatory function.. This part, with B0015, forms a composite part that has length 250 bp. false Allen Lin BBa_K137071_sequence 1 taaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctggctctagtagtgatctacactagcactatcagtgttattaagctactaaagcgtagtttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z