BBa_K137087 1 BBa_K137087 optimized (TA) repeat constitutive promoter with 17 bp between -10 and -35 elements 2008-08-20T11:00:00Z 2015-05-08T01:10:10Z PCR optimized (TA) repeat constitutive promoter with 17 bp between -10 and -35 elements false false _187_ 0 3112 9 Not in stock false None false Allen Lin BBa_K137087_sequence 1 ttgacaatatatatatatatatatataatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z