BBa_K137127 1 BBa_K137127 A81 Lac Promoter - Tight expression levels 2008-10-15T11:00:00Z 2015-05-08T01:10:11Z Cox RS III, Surette MG, Elowitz MB. Programming gene expression with combinatorial promoters. Mol. Syst. Biol. 2007;3:145. A lactose inducible promoter obtained from: Cox RS III, Surette MG, Elowitz MB. Programming gene expression with combinatorial promoters. Mol. Syst. Biol. 2007;3:145. Used for tight expression levels to maintain our lysis cassette genes. This allows the cell to lyse only when lactose is present, as for lysis at any other time may cause problems in our system. true false _187_ 0 2018 9 Discontinued false Ordered primers to PCR them out of the original plasmid, but they failed. Decided to order long primers and "dimerized" the promoter with restriction sites at the ends. false Robert Ovadia BBa_K137127_sequence 1 tatatctagagtacaacgtcgtgttagctgcaattgtgagcggataacaattgacatagcggatacttcctgatataattcgtgcaatttttaaacctgtaggatcgtacaggttactagtagcggccgctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z