BBa_K137128 1 BBa_K137128 B4 Lac Promoter - Tight expression levels 2008-10-15T11:00:00Z 2015-05-08T01:10:11Z Cox RS III, Surette MG, Elowitz MB. Programming gene expression with combinatorial promoters. Mol. Syst. Biol. 2007;3:145. An additional lactose inducible promoter (similar to A81) obtained from: Cox RS III, Surette MG, Elowitz MB. Programming gene expression with combinatorial promoters. Mol. Syst. Biol. 2007;3:145. Used for tight expression levels to maintain our lysis cassette genes. This allows the cell to lyse only when lactose is present, as for lysis at any other time may cause problems in our system. true false _187_ 0 2018 9 Discontinued false Ordered long primers and "dimerized" the promoter with restriction sites at the ends. false Robert Ovadia BBa_K137128_sequence 1 tatatctagagtacaacgtcgtgttagttgcaattgtgagcggataacaattgacttgtgagcggataacaatgatacttcgtgcaatttttaaaattaaaggcgttacccaactactagtagcggccgctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z