BBa_C0076 1 cinI autoinducer synthetase 2004-01-27T12:00:00Z 2015-08-31T04:07:24Z Rhizobium leguminosarum Released HQ 2013 cinI codes for an autoinducer synthetase which utilizes SAM to make O3-C14:1-HSL. In complex with O3-C14:1-HSL, CinR (BBa_C0077) binds to the Cin promoter (BBa_R0077) and activates transcription. false false _1_ 0 24 7 In stock false The regulatory locus cinRI in Rhizobium leguminosarum conrols a network of quorum-sensing loci Lithgow, JK; Wilkinson, A; Hardman, A; Rodelas, B; Wisniewski-Dye, F; Williams, P; Downie, AJ MOL. MICROBIOLOGY 37(1): 81-97, 2000 <P>Change log: original STOP: tga -> tAaTAA true crackdots annotation2214001 1 Help:Barcodes range2214001 1 703 727 annotation301035 1 CinI range301035 1 1 663 annotation306586 1 LVA range306586 1 664 696 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K1375012 1 BBa_K1375012 RBS+CinI+DT 2014-10-09T11:00:00Z 2015-05-08T01:10:11Z PCR from part BBa_ I761014 This part is a coding sequence that express CinI protein false false _1752_ 0 18474 9 It's complicated false no false Zheng Xu component2416182 1 BBa_C0076 component2416189 1 BBa_B0015 component2416178 1 BBa_B0034 annotation2416189 1 BBa_B0015 range2416189 1 754 882 annotation2416182 1 BBa_C0076 range2416182 1 19 745 annotation2416178 1 BBa_B0034 range2416178 1 1 12 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_K1375012_sequence 1 aaagaggagaaatactagatgttcgttatcatccaggctcacgaataccagaaatacgctgctgttctggaccagatgttccgtctgcgtaaaaaagttttcgctgacaccctgtgctgggacgttccggttatcggtccgtacgaacgtgactcctacgactccctggctccggcttacctggtttggtgcaacgactcccgtacccgtctgtacggtggtatgcgtctgatgccgaccaccggtccgaccctgctgtacgacgttttccgtgaaaccttcccggacgctgctgacctgatcgctccgggtatctgggaaggtacccgtatgtgcatcgacgaagaagctatcgctaaagacttcccggaaatcgacgctggtcgtgctttctccatgatgctgctggctctgtgcgaatgcgctctggaccacggtatccacaccatgatctccaactacgaaccgtacctgaaacgtgtttacaaacgtgctggtgctgaagttgaagaactgggtcgtgctgacggttacggtaaatacccggtttgctgcggtgctttcgaagtttccgaccgtgttctgcgtaaaatgcgtgctgctctgggtctgaccctgccgctgtacgttcgtcacgttccggctcgttccgttgttacccagttcctggaaatggctgctgctgctaacgacgaaaactacgctctggttgcttaataaccctgatagtgctagtgtagatccctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_C0076_sequence 1 atgttcgttatcatccaggctcacgaataccagaaatacgctgctgttctggaccagatgttccgtctgcgtaaaaaagttttcgctgacaccctgtgctgggacgttccggttatcggtccgtacgaacgtgactcctacgactccctggctccggcttacctggtttggtgcaacgactcccgtacccgtctgtacggtggtatgcgtctgatgccgaccaccggtccgaccctgctgtacgacgttttccgtgaaaccttcccggacgctgctgacctgatcgctccgggtatctgggaaggtacccgtatgtgcatcgacgaagaagctatcgctaaagacttcccggaaatcgacgctggtcgtgctttctccatgatgctgctggctctgtgcgaatgcgctctggaccacggtatccacaccatgatctccaactacgaaccgtacctgaaacgtgtttacaaacgtgctggtgctgaagttgaagaactgggtcgtgctgacggttacggtaaatacccggtttgctgcggtgctttcgaagtttccgaccgtgttctgcgtaaaatgcgtgctgctctgggtctgaccctgccgctgtacgttcgtcacgttccggctcgttccgttgttacccagttcctggaaatggctgctgctgctaacgacgaaaactacgctctggttgcttaataaccctgatagtgctagtgtagatccc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z