BBa_K1375024 1 BBa_K1375024 Prhl/las +RBS 2014-10-09T11:00:00Z 2015-05-08T01:10:12Z The total synthesis of DNA and connected with a B0015 This is a regulated promoter with a RBS false false _1752_ 0 18474 9 In stock false No false Zheng Xu annotation2415999 1 b0034 range2415999 1 64 75 BBa_K1375024_sequence 1 tcctgtgaaatctggcagttaccgatctatctcatttgctagttataatgtgttcactactagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z