BBa_K1378032 1 BBa_K1378032 Endolysin from lambda phage 2014-09-27T11:00:00Z 2015-05-08T01:10:12Z We get this part by de novo synthesis. Endolysin is a kind of peptidoglycan hydrolase that are secreted by double-stranded DNA lambda phage to comprise the bacterial cell wall at the end of infection cycle.However, itself can not digest the peptidoglycan on its own because endolysin can not pass through the inner membrane unless there are other molecules' assistance. false false _1755_ 0 21239 9 It's complicated false Endolysin is not able to pass through the inner membrane, so there must be other molecules helping them, if we want to utilise it. false Wu Jie annotation2427076 1 endolysin range2427076 1 1 477 BBa_K1378032_sequence 1 atggtagaaatcaataatcaacgtaaggcgttcctcgatatgctggcgtggtcggagggaactgataacggacgtcagaaaaccagaaatcatggttatgacgtcattgtaggcggagagctatttactgattactccgatcaccctcgcaaacttgtcacgctaaacccaaaactcaaatcaacaggcgccggacgctaccagcttctttcccgttggtgggatgcctaccgcaagcagcttggcctgaaagacttctctccgaaaagtcaggacgctgtggcattgcagcagattaaggagcgtggcgctttacctatgattgatcgtggtgatatccgtcaggcaatcgaccgttgcagcaatatctgggcttcactgccgggcgctggttatggtcagttcgagcataaggctgacagcctgattgcaaaattcaaagaagcgggcggaacggtcagagagattgatgtatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z