BBa_K1379001 1 BBa_K1379001 P<sub>comFA</sub> 2014-09-21T11:00:00Z 2015-05-08T01:10:12Z This promoter is found in genomic sequence of Streptococcus pneumoniae NCTC7465 strain SigmaX-dependent promoter initiating the transcription of helicase false false _1756_ 0 21235 9 In stock false N/A false Ng Siu Wang Edward, Jason Jang, Joo Min Jung annotation2385396 1 PcomFA range2385396 1 1 160 annotation2386514 1 Com-Box range2386514 1 79 86 BBa_K1379001_sequence 1 tggacttggccgtcctctttaattgtcctaaattccatgatttaattgtactaaaaaatcatctaaagtgctagtttttacgaataaagaagtatgaaagtaaatttagattatctcggtcgtttatttactgagaatgaattaacagaagaagaacgtc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z