BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K175032 1 KMR Key for lock of medium (K175031) RBS (B0032) from the lock/key library TUD09 2009-09-30T11:00:00Z 2015-05-08T01:10:59Z The biobrick was designed using the lock/key library algorithm constructed by TUDelft iGEM 09 team. The algorithm is based on the work of Isaacs F. et al 2004, Berkeley iGEM 2006, Caltech iGEM 2007 and Peking iGEM 2007. This biobrick generates a mRNA which forms a secondary structure that opens LMR (K175031). false false _280_ 0 4299 9 In stock true Functionality is being tested false Daniel Solis Escalante BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K1379027 1 BBa_K1379027 K175032-B0015 2014-09-22T11:00:00Z 2015-05-08T01:10:12Z Synthetic Trans-Activator with terminator for MCR false false _1756_ 0 16893 9 Not in stock false intermediate false Medina Cuellar Raul Guillermo component2425086 1 BBa_B0015 component2425079 1 BBa_K175032 annotation2425086 1 BBa_B0015 range2425086 1 93 221 annotation2425079 1 BBa_K175032 range2425079 1 1 84 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K175032_sequence 1 acccaaagtcctcacacaggaaagtggttaatgaaaattaacttactttcctgactgaaaaaagccgagttattaatccggctt BBa_K1379027_sequence 1 acccaaagtcctcacacaggaaagtggttaatgaaaattaacttactttcctgactgaaaaaagccgagttattaatccggctttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z