BBa_K138000 1 BBa_K138000 NifHp in BioBrick Compatible Leucine Landing Pad 2008-10-08T11:00:00Z 2015-05-08T01:10:13Z The Leucine Landing Pad was built by Dong Eun Chang, a former member of the Ninfa Lab. nifHp was a PCR product, with the template being pRT22, a nifH-lacZ recorder plasmid. This construct was provided to us by Dr. Ray Dixon of the John Innes Center in the United Kingdom. The NifH promoter was subcloned into the leucine landing pad using Xba and Nde. Other genetic elements can be subcloned behind the promoter using either NdeI/SpeI or NdeI/PstI (or other combinations). The linker region is the following: EcorI-XbaI- NifHp- NdeI- PacI-SpeI-PstI. false false _204_ 0 3575 9 It's complicated false Landing pad has ampicillin and chloramphenicol resistance; see protocol on Michigan's wiki on how to get the things in the landing pad on the chromosome false Amrit Misra BBa_K138000_sequence 1 aacgcgttatgaagagagtcgccgcgcagcgcgccaagagattgcgtggaataagacacagggggcgacaagctgttgaacaggcgacaaagcgcccatggccccggcaggcgcaattgttctgtttcccacatttggtcgccttattgtgccgttttgttttacgtcctgcgcggcgacaaataactaacttcataaaaatcataagaatacataaacaggcacggctggtatgttccctgcacttctctgctggcaaacactcaacaacaggagaagtcacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z