BBa_K1381000 1 yenbox_WT yenbox_WT 2014-10-01T11:00:00Z 2015-05-08T01:10:13Z The source of this part is Yersinia enterocolitica. yenbox_WT consists of a wildtype promoter originated from Yersinia enterocolitica upstreams of a luxbox homoloug, called the yenbox. When interaction between the yenbox and the activator YenR occur, the base level of expression of the promoter is induced. false false _1758_ 0 17260 9 In stock false The part sequence was taken straight of from the genome of Y. enterocolitica. false Stephanie Herman, Gunta Celma, Megha Biradar, Christoffer Andersson and Martin Friberg annotation2391900 1 Wildtype promoter range2391900 1 46 82 annotation2391902 1 yenbox range2391902 1 1 48 BBa_K1381000_sequence 1 aaacctagaccaaagtatagtttagataactagacctaaggctagctattattatacccctatgttaattaaactgtttttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z