BBa_K1381001 1 yenbox_J23 yenbox_J23113 2014-10-01T11:00:00Z 2015-05-08T01:10:13Z The sequence of the yenbox was taken from Y. enterocoliticas genome and the promoter sequence of the promoter was taken from the Anderson promoter J23113 (BBa_J23113). yenbox_J23113 consists of the Anderson promoter J23113 fused togheter upstreams of a luxbox homoloug, called the yenbox. When interaction between the yenbox and the activator YenR occur, the base level of expression of the promoter should be induced. But this has been shown not to work. Probably the changed bases in the end of the yenbox, prevent the interaction between YenR and the yenbox from happening. false false _1758_ 0 17260 9 In stock false The source of the yenbox in this part is Y. enterocolitica and the source of the promoter is from the BioBrick BBa_J23113. false Stephanie Herman, Gunta Celma, Megha Biradar, Christoffer Andersson and Martin Friberg annotation2391914 1 J23113 range2391914 1 46 80 annotation2391913 1 yenbox range2391913 1 1 45 BBa_K1381001_sequence 1 aaacctagaccaaagtatagtttagataactagacctaaggctagctgatggctagctcagtcctagggattatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z