BBa_K1381004 1 YenR B0034-YenR 2014-10-01T11:00:00Z 2015-05-08T01:10:13Z The source of this part is Yersinia enterocolitica. YenR is an activator originated from Yersinia enterocolitica. It induces the expression of the yenbox_WT, the yenbox fused with a wildtype promoter from Y. enterocolitica. Both YenR and the yenbox_WT are parts in the Yen system, which is a homolougous system to the Lux system. It is the quorum sensing system derivated from Y. enterocolitica and it senses the presence of Y. enterocoliticas unique quorum sensing molecules, the OHHL:s (3-oxo-hexanoyl homoserine lactone). When the OHHL enters the host, it interacts with YenR, making it loose its shape and thereby preventing it from binding to the yenbox. So in the presence of Y. enterocolitica the induction of the expression will be lost. false false _1758_ 0 17260 9 In stock false The coding sequence of YenR was codon optimized for E. coli. false Stephanie Herman, Gunta Celma, Megha Biradar, Christoffer Andersson and Martin Friberg annotation2392210 1 YenR range2392210 1 19 753 annotation2392209 1 B0034 range2392209 1 1 12 BBa_K1381004_sequence 1 aaagaggagaaatactagatgatcattgactattttgataatgaaagcattaacgaagacattaaaaattatatccagcgccgtattaaagcgtacggcgacctgcgctactcttatctggttatgaataaaaagactccattgcacccgaccattatttctaactatccgcttgattgggttaagaaatataaaaaaaatagctaccacctgattgatcctgtaatccttaccgcgaaggataaagtggcgcctttcgcgtgggatgataactcggtgatcaataaaaaatccaccgactccgctgtttttaaactggcgcgcgagtacaatattgttaacggctacaccttcgtgttacacgataattctaacaacatggcaacactcaatattagcaacggtagcgacgacagtatctcatttgacgaatcaattgagattaacaaagagaaaattcagatgctgctgattctgactcatgaaaaaatgttgggcctgtatcaaagtaatagcgacaagaacgaaaaccgtaatccaaaaatcgaacgtgacattttcagcccgcgggaaaatgaaatcctgtactgggcctctgtgggaaaaacatatgcggaaatctcaatcatcctgggtatcaaacgctcgacagtcaaattccatattggcaacgtcgttcgtaaactcggcgtgttgaacgcgaagcatgcaatccggcttggcatcgaattgaagctgattaaacccatctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z