BBa_J23110 1 BBa_J23110 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1381005 1 BBa_K1381005 J23110-B0034-YenR 2014-10-01T11:00:00Z 2015-05-08T01:10:13Z The source of this part is Yersinia enterocolitica. The activator YenR coupled to the constitutive Anderson promoter J23110. YenR creates the induction of expression in the Yen system, a homologous system to the Lux system. false false _1758_ 0 17260 9 It's complicated false The coding sequence for YenR has been codon optimized for E. coli. false Stephanie Herman, Gunta Celma, Megha Biradar, Christoffer Andersson and Martin Friberg component2392222 1 BBa_K1381004 component2392219 1 BBa_B0034 component2392217 1 BBa_J23110 annotation2392217 1 BBa_J23110 range2392217 1 1 35 annotation2392222 1 BBa_K1381004 range2392222 1 64 816 annotation2392219 1 BBa_B0034 range2392219 1 44 55 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1381004 1 YenR B0034-YenR 2014-10-01T11:00:00Z 2015-05-08T01:10:13Z The source of this part is Yersinia enterocolitica. YenR is an activator originated from Yersinia enterocolitica. It induces the expression of the yenbox_WT, the yenbox fused with a wildtype promoter from Y. enterocolitica. Both YenR and the yenbox_WT are parts in the Yen system, which is a homolougous system to the Lux system. It is the quorum sensing system derivated from Y. enterocolitica and it senses the presence of Y. enterocoliticas unique quorum sensing molecules, the OHHL:s (3-oxo-hexanoyl homoserine lactone). When the OHHL enters the host, it interacts with YenR, making it loose its shape and thereby preventing it from binding to the yenbox. So in the presence of Y. enterocolitica the induction of the expression will be lost. false false _1758_ 0 17260 9 In stock false The coding sequence of YenR was codon optimized for E. coli. false Stephanie Herman, Gunta Celma, Megha Biradar, Christoffer Andersson and Martin Friberg annotation2392210 1 YenR range2392210 1 19 753 annotation2392209 1 B0034 range2392209 1 1 12 BBa_K1381005_sequence 1 tttacggctagctcagtcctaggtacaatgctagctactagagaaagaggagaaatactagagaaagaggagaaatactagatgatcattgactattttgataatgaaagcattaacgaagacattaaaaattatatccagcgccgtattaaagcgtacggcgacctgcgctactcttatctggttatgaataaaaagactccattgcacccgaccattatttctaactatccgcttgattgggttaagaaatataaaaaaaatagctaccacctgattgatcctgtaatccttaccgcgaaggataaagtggcgcctttcgcgtgggatgataactcggtgatcaataaaaaatccaccgactccgctgtttttaaactggcgcgcgagtacaatattgttaacggctacaccttcgtgttacacgataattctaacaacatggcaacactcaatattagcaacggtagcgacgacagtatctcatttgacgaatcaattgagattaacaaagagaaaattcagatgctgctgattctgactcatgaaaaaatgttgggcctgtatcaaagtaatagcgacaagaacgaaaaccgtaatccaaaaatcgaacgtgacattttcagcccgcgggaaaatgaaatcctgtactgggcctctgtgggaaaaacatatgcggaaatctcaatcatcctgggtatcaaacgctcgacagtcaaattccatattggcaacgtcgttcgtaaactcggcgtgttgaacgcgaagcatgcaatccggcttggcatcgaattgaagctgattaaacccatctaa BBa_K1381004_sequence 1 aaagaggagaaatactagatgatcattgactattttgataatgaaagcattaacgaagacattaaaaattatatccagcgccgtattaaagcgtacggcgacctgcgctactcttatctggttatgaataaaaagactccattgcacccgaccattatttctaactatccgcttgattgggttaagaaatataaaaaaaatagctaccacctgattgatcctgtaatccttaccgcgaaggataaagtggcgcctttcgcgtgggatgataactcggtgatcaataaaaaatccaccgactccgctgtttttaaactggcgcgcgagtacaatattgttaacggctacaccttcgtgttacacgataattctaacaacatggcaacactcaatattagcaacggtagcgacgacagtatctcatttgacgaatcaattgagattaacaaagagaaaattcagatgctgctgattctgactcatgaaaaaatgttgggcctgtatcaaagtaatagcgacaagaacgaaaaccgtaatccaaaaatcgaacgtgacattttcagcccgcgggaaaatgaaatcctgtactgggcctctgtgggaaaaacatatgcggaaatctcaatcatcctgggtatcaaacgctcgacagtcaaattccatattggcaacgtcgttcgtaaactcggcgtgttgaacgcgaagcatgcaatccggcttggcatcgaattgaagctgattaaacccatctaa BBa_B0034_sequence 1 aaagaggagaaa BBa_J23110_sequence 1 tttacggctagctcagtcctaggtacaatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z