BBa_K1381013 1 BBa_K1381013 J23100-B0034-CheZ 2014-10-02T11:00:00Z 2015-05-08T01:10:13Z - Insert source - - Insert description - false false _1758_ 0 17260 9 It's complicated false - Insert design considerations - false Andries Boers, Eric Sandstrom, Kira Karlsson, Miranda Steirnborg and Jennifer Rosenius component2392528 1 BBa_J23100 component2392537 1 BBa_K629003 component2392530 1 BBa_B0034 annotation2392537 1 BBa_K629003 range2392537 1 62 706 annotation2392530 1 BBa_B0034 range2392530 1 44 55 annotation2392528 1 BBa_J23100 range2392528 1 1 35 BBa_K629003 1 cheZ cheZ, chemotaxis regulator, protein phosphatase for CheY 2011-10-02T11:00:00Z 2015-05-08T01:12:56Z genome of E. Coli BL21 plys strain Released HQ 2013 Polar localization is dependent on CheA-short. CheZ is a cytosolic phosphatase which functions in the chemotaxis signal transduction complex. Plays an important role in bacterial chemotaxis signal transduction pathway by accelerating the dephosphorylation of phosphorylated CheY (CheY-P). false false _801_ 0 9022 9 In stock false how to control the proper expression of cheZ false Zilong WANG, Yi ZHENG annotation2154423 1 rev primer range2154423 1 624 645 annotation2154424 1 terminator range2154424 1 643 645 annotation2154425 1 CheZ range2154425 1 1 645 annotation2154422 1 start range2154422 1 1 3 annotation2154421 1 fwd primer range2154421 1 1 20 annotation2155668 1 TGA to TAA range2155668 1 643 645 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_B0034_sequence 1 aaagaggagaaa BBa_K629003_sequence 1 atgatgcaaccatcaatcaaacctgctgacgagcattcagctggcgatatcattgcgcgcatcggcagcctgacgcgtatgctgcgcgacagtttgcgggaactggggctggatcaggccattgccgaagcggcggaagccatccccgatgcgcgcgatcgtttgtactatgttgtgcagatgaccgcccaggctgcggagcgggcgctgaacagtgttgaggcgtcacaaccgcatcaggatcaaatggagaaatcagcaaaagcgttaacccaacgttgggatgactggtttgccgatccgattgaccttgccgacgcccgtgaactggtaacagatacacgacaatttctggcagatgtacccgcgcataccagctttactaacgcgcaactgctggaaatcatgatggcgcaggattttcaggatctcaccgggcaggtcattaagcggatgatggatgtcattcaggagatcgaacgccagttgctgatggtgctgttggaaaacatcccggaacaggagtcgcgtccaaaacgtgaaaaccagagtttgcttaatggacctcaggtcgataccagcaaagccggtgtggtagccagtcaggatcaggtggacgatttgttggatagtcttggattttaa BBa_K1381013_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaatactagatgatgcaaccatcaatcaaacctgctgacgagcattcagctggcgatatcattgcgcgcatcggcagcctgacgcgtatgctgcgcgacagtttgcgggaactggggctggatcaggccattgccgaagcggcggaagccatccccgatgcgcgcgatcgtttgtactatgttgtgcagatgaccgcccaggctgcggagcgggcgctgaacagtgttgaggcgtcacaaccgcatcaggatcaaatggagaaatcagcaaaagcgttaacccaacgttgggatgactggtttgccgatccgattgaccttgccgacgcccgtgaactggtaacagatacacgacaatttctggcagatgtacccgcgcataccagctttactaacgcgcaactgctggaaatcatgatggcgcaggattttcaggatctcaccgggcaggtcattaagcggatgatggatgtcattcaggagatcgaacgccagttgctgatggtgctgttggaaaacatcccggaacaggagtcgcgtccaaaacgtgaaaaccagagtttgcttaatggacctcaggtcgataccagcaaagccggtgtggtagccagtcaggatcaggtggacgatttgttggatagtcttggattttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z