BBa_K1381015 1 BBa_K1381015 Silencing sRNA (15 bases long) for USP45 (Based on Spot42) 2014-10-06T11:00:00Z 2015-05-08T01:10:13Z Spot42 Mutageneseis of the antisense site of BBa_K864440 contains J23101 promoter false false _1758_ 0 17571 9 In stock false 10 an 20 version as well false Alexander Wirtanen, Niklas Handin, Marcus Hong and Jonas Mattisson annotation2417854 1 J23101 range2417854 1 1 35 annotation2417855 1 15bp antisense-RNA for usp45 range2417855 1 36 50 annotation2417856 1 Spot42 Scaffold range2417856 1 51 103 BBa_K1381015_sequence 1 tttacagctagctcagtcctaggtattatgctagcattttctttttcatcatttggctgaatattttagccgccccagtcagtaatgactggggcgtttttta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z