BBa_K339010 1 BBa_K339010 ibpAB 2010-10-24T11:00:00Z 2015-05-08T01:12:07Z b Inclusion Body Binding Protein Promoter Region false false _460_ 0 4377 9 It's complicated false EFGH false Emily Hicks annotation2113585 1 START range2113585 1 1 3 annotation2113586 1 STOP range2113586 1 267 269 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1387005 1 BBa_K1387005 pIBPAB - B0034 2014-10-06T11:00:00Z 2015-05-08T01:10:13Z We design this part through kit plate igem, but we got this part from synthetic gene This part consist of pIBPAB fusion promoter and RBS (B0034) that can active if inclusion bodies was formed in the cell. It part can combined with another part to more useful. false false _1764_ 0 20698 9 It's complicated false We want a regulator that can be induced by inclusion body false Tri Ekawati Heryanto, Joko Pebrianto Trinugroho, Pande Putu Erawijantari, Nimas Ghasani, Risma Wiharyanti, Gilang Tirta Widi component2400296 1 BBa_K339010 component2400298 1 BBa_B0034 annotation2400298 1 BBa_B0034 range2400298 1 279 290 annotation2400296 1 BBa_K339010 range2400296 1 1 270 BBa_B0034_sequence 1 aaagaggagaaa BBa_K339010_sequence 1 aaactgcaaaaaaaagtccgctgataagcttgaaaagttcatttccagacccatttttacatcgtagccgatgaggacgcgcctgatgggtgttctggctacctgacctgtccattgtggaaggtcttacattctcgctgatttaaattctgggattactaccaaaatagttgcgcaaacatcttgaaattttgctaatgaccacaatataagctaacgcgattcgcaacccattcaggtagccggggttaaccggctgctattaataaa BBa_K1387005_sequence 1 aaactgcaaaaaaaagtccgctgataagcttgaaaagttcatttccagacccatttttacatcgtagccgatgaggacgcgcctgatgggtgttctggctacctgacctgtccattgtggaaggtcttacattctcgctgatttaaattctgggattactaccaaaatagttgcgcaaacatcttgaaattttgctaatgaccacaatataagctaacgcgattcgcaacccattcaggtagccggggttaaccggctgctattaataaatactagagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z