BBa_K936014 1 BBa_K936014 pelB-LC-Cutinase with polyhistidine-tag 2012-08-08T11:00:00Z 2015-05-08T01:13:47Z This part was created from other BioBrick parts. pelB leader sequence attached to enzyme LC-Cutinase protein coding sequence in order to allow the cell to bring the enzyme to the periplasm for easier secretion. The polyhistidine-tag allows for us to purify the produced enzyme. false true _1201_ 0 10185 9 Not in stock false We designed the pelB tag to be immediately in front of the LC-cutinase gene. false Nicholas Csicsery annotation2181454 1 pelB range2181454 1 1 66 annotation2181456 1 Polyhistidine-tag range2181456 1 946 963 annotation2181455 1 LC-Cutinase range2181455 1 67 945 BBa_B1002 1 BBa_B1002 Terminator (artificial, small, %T~=85%) 2006-08-29T11:00:00Z 2015-08-31T04:07:21Z antiquity Artifical terminator, estimated %T~=85 false true _41_ 0 745 41 In stock false Bidirectional, with the reverse estimated to be less effective than the forward. Has a polyA tail of 6 residues. true Haiyao Huang annotation1898412 1 B1002 range1898412 1 1 34 annotation1898414 1 Poly A tail range1898414 1 25 31 annotation1898415 1 Poly A tail range1898415 1 4 9 annotation1898413 1 stem loop range1898413 1 10 25 BBa_K1387006 1 BBa_K1387006 J23106 - tetO - B0034 - lpp ompA-LC-Cutinase - B1002 2014-09-28T11:00:00Z 2015-05-08T01:10:13Z This part, we desgned through synthetic gene (G-Blocks) The casette of degradation module is comprised of constitutive promoter, tet operator, RBS, outer membrane protein A (ompA) fused with LC Cutinase, and double terminator. By using constitutive promoter, we expect the recombinant protein, in this case ompA-LC Cutinase, will be synthesized indefinitely. ompA is outer membrane protein. It comprises of &#946;???strand B3-B7. Rather than using full sequence of ompA, we use ompA (46-159) fused with lipoprotein signal sequence, thus exposing it on the cell surface of bacteria1. We fuse lpp-ompA with LC Cutinase, an enzyme that exhibit esterase activity. LC-Cutinase esterase activity will cleave the ester bond on PET and releasing terephthalic acid and ethylene glycol as a product. Fusion strategy of lpp-ompA on LC Cutinase gene is one of our way to create a whole cell biocatalyst which will be an effective molecular machinery to degrade PET on the environment. Due to constitutive expression of the recombinant protein in E.coli, there is a possibility of formation of insoluble protein inside the cell (inclusion body), because of that, we put tet operator upstream of RBS for further regulation. false false _1764_ 0 20698 9 It's complicated false Fusion strategy of lpp-ompA on LC Cutinase gene is one of our way to create a whole cell biocatalyst false Tri Ekawati Heryanto, Joko Pebrianto Trinugroho, Pande Putu Erawijantari, Nimas Ghasani, Risma Wiharyanti, Gilang Tirta Widi, Oktira Roka Aji component2388102 1 BBa_K103006 component2388093 1 BBa_J23106 component2388096 1 BBa_B0034 component2388111 1 BBa_B1002 component2388106 1 BBa_K936014 component2388094 1 BBa_K079036 annotation2388102 1 BBa_K103006 range2388102 1 87 550 annotation2388094 1 BBa_K079036 range2388094 1 44 58 annotation2388111 1 BBa_B1002 range2388111 1 1534 1567 annotation2388096 1 BBa_B0034 range2388096 1 67 78 annotation2388106 1 BBa_K936014 range2388106 1 557 1525 annotation2388093 1 BBa_J23106 range2388093 1 1 35 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K103006 1 OmpA OmpA outer membrane protein A fused to linker; displays proteins on cell surface 2008-09-13T11:00:00Z 2015-05-08T01:08:46Z One of our basic bricks used to create fusions attached to outer membrane false true _180_ 0 2582 9 In stock true true Michael Lower annotation1990001 1 linker range1990001 1 439 464 annotation1990000 1 OmpA range1990000 1 4 438 annotation1989999 1 NdeI range1989999 1 1 7 annotation1990002 1 SacI range1990002 1 459 464 annotation1993480 1 ATG range1993480 1 4 6 BBa_K079036 1 BBa_K079036 Tet O operator library member 2008-10-24T11:00:00Z 2015-05-08T01:08:34Z .. .. false false _185_ 0 3530 9 Not in stock true .. false Francesca Ceroni BBa_J23106 1 BBa_J23106 constitutive promoter family member 2006-08-13T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K103006_sequence 1 catatgaaagctactaaactggtactgggcgcggtaatcctgggttctactctgctggcaggttgctccagcaacgctaaaatcgatcagggaattaacccgtatgttggctttgaaatgggttacgactggttaggtcgtatgccgtacaaaggcagcgttgaaaacggtgcatacaaagctcagggcgttcaactgaccgctaaactgggttacccaatcactgacgacctggacatctacactcgtctgggtggcatggtatggcgtgcagacactaaatccaacgtttatggtaaaaaccacgacaccggcgtttctccggtcttcgctggcggtgttgagtacgcgatcactcctgaaatcgctacccgtctggaataccagtggaccaacaacatcggtgacgcacacaccatcggcactcgtccggacaacggcggaggttctggaggagggagctc BBa_B1002_sequence 1 cgcaaaaaaccccgcttcggcggggttttttcgc BBa_B0034_sequence 1 aaagaggagaaa BBa_K079036_sequence 1 cctatcagtgataga BBa_K936014_sequence 1 atgaaatacctgctgccgaccgctgctgctggtctgctgctcctcgctgcccagccggcgatggccatggacggagttctctggcgagtgcgaaccgcggcgctcatggccgcgctgctcgccctcgcagcctgggcgctggtctgggcttcgcccagcgtcgaggctcaatccaacccgtaccagcgcggtcccaaccccacgcggagcgcgctcacggccgacgggccgttctcggtggcaacctacaccgtttcgcggctctcggtgagcggcttcgggggcggggtgatctactaccccacaggcacctcgctgaccttcggcgggatcgccatgtcgccggggtacacggccgacgccagttcgctggcgtggctcgggcggcggttggcatcgcacggcttcgtggtgctcgtcatcaacacgaactcgcgattcgactaccctgactcccgcgcaagccagctatcggcggcgctgaactacctgcggacgagcagcccctcagccgtacgcgcccggctcgatgcgaaccgcctggccgttgcggggcattcgatgggcggcggcgggaccctccgcatcgcagagcagaacccgtcgctgaaagcggccgtaccgctcacgccgtggcacaccgacaagacgttcaacacgtcggtaccggtgctcatcgtgggagcggaagcggacacggtcgcgcccgtgagccagcacgccattccgttctaccagaacttgccctcgaccacgccgaaggtgtacgtggagctcgacaatgcgtcgcacttcgcgcccaacagcaacaacgcggcgatctccgtgtacaccatctcgtggatgaagctgtgggtggataacgacacccgctaccggcagttcctctgcaacgtgaacgatccggcgctgagcgacttccggacgaacaaccgccactgccagcatcaccaccatcaccattagtaa BBa_J23106_sequence 1 tttacggctagctcagtcctaggtatagtgctagc BBa_K1387006_sequence 1 tttacggctagctcagtcctaggtatagtgctagctactagagcctatcagtgatagatactagagaaagaggagaaatactagagcatatgaaagctactaaactggtactgggcgcggtaatcctgggttctactctgctggcaggttgctccagcaacgctaaaatcgatcagggaattaacccgtatgttggctttgaaatgggttacgactggttaggtcgtatgccgtacaaaggcagcgttgaaaacggtgcatacaaagctcagggcgttcaactgaccgctaaactgggttacccaatcactgacgacctggacatctacactcgtctgggtggcatggtatggcgtgcagacactaaatccaacgtttatggtaaaaaccacgacaccggcgtttctccggtcttcgctggcggtgttgagtacgcgatcactcctgaaatcgctacccgtctggaataccagtggaccaacaacatcggtgacgcacacaccatcggcactcgtccggacaacggcggaggttctggaggagggagctctactagatgaaatacctgctgccgaccgctgctgctggtctgctgctcctcgctgcccagccggcgatggccatggacggagttctctggcgagtgcgaaccgcggcgctcatggccgcgctgctcgccctcgcagcctgggcgctggtctgggcttcgcccagcgtcgaggctcaatccaacccgtaccagcgcggtcccaaccccacgcggagcgcgctcacggccgacgggccgttctcggtggcaacctacaccgtttcgcggctctcggtgagcggcttcgggggcggggtgatctactaccccacaggcacctcgctgaccttcggcgggatcgccatgtcgccggggtacacggccgacgccagttcgctggcgtggctcgggcggcggttggcatcgcacggcttcgtggtgctcgtcatcaacacgaactcgcgattcgactaccctgactcccgcgcaagccagctatcggcggcgctgaactacctgcggacgagcagcccctcagccgtacgcgcccggctcgatgcgaaccgcctggccgttgcggggcattcgatgggcggcggcgggaccctccgcatcgcagagcagaacccgtcgctgaaagcggccgtaccgctcacgccgtggcacaccgacaagacgttcaacacgtcggtaccggtgctcatcgtgggagcggaagcggacacggtcgcgcccgtgagccagcacgccattccgttctaccagaacttgccctcgaccacgccgaaggtgtacgtggagctcgacaatgcgtcgcacttcgcgcccaacagcaacaacgcggcgatctccgtgtacaccatctcgtggatgaagctgtgggtggataacgacacccgctaccggcagttcctctgcaacgtgaacgatccggcgctgagcgacttccggacgaacaaccgccactgccagcatcaccaccatcaccattagtaatactagagcgcaaaaaaccccgcttcggcggggttttttcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z