BBa_K1388001 1 BBa_K1388001 aeBlue-aacC1 gene cassette for integron testing 2014-10-06T11:00:00Z 2015-05-08T01:10:13Z Synthesised as a complete gBlock gene fragment from Integrated DNA Technologies: attC sequence was sourced from pUS23 and aacC1 was sourced from pUCP24. aeBlue sequence was taken from part BBa_K864401. This part is used to produce circular gene cassettes for integron testing. It contains (in order): - A spacer region designed to allow circularisation primers to anneal (this avoids secondary structure problems caused by attC, see below) - An NheI restriction site - An attC integron recombination site - An aeBlue gene (see BBa_K864401) with RBS - BamHI restriction site - An aacC1 gene with RBS (confers resistance to gentamicin). Cassettes can be produced by using Xba/SpeI or NheI/SpeI ELAN (cutting at the prefix/suffix or and ligating each end of the part together at these points) or using Gibson assembly; Gibson circularisation can be carried out by running PCR using primers with reverse-complementary 5 prime ends and 3' ends which anneal respectively to the spacer region and the end of aacC1. Examples of circularisation primers given below: F: 5'-GAGGTCGGACAGTATATTGAAACGTCAGGAGTCTAGATACCGAGGGACAGACTACCAACTCACA-3' R: 5'-GTATCTAGACTCCTGACGTTTCAATATACTGTCCGACCTCTTATTAGGTGGCGGTACTTGGGTCG-3' false false _1765_ 0 21865 9 In stock true - attC placed at beginning of part to allow for the option of cointegration of plasmids using integron recombination (retaining aeBlue/aacC1 near attI site and any nearby promoters). - 5' spacer region included to allow for primer annealing; attC has significant secondary structure which can make primer design difficult. - NheI was placed to allow ELAN circularisation without SpeI without including unnecessary spacer region. - BamHI was placed to allow excision of aacC1 gene with BamHI/Spe digest. false Tom Geddes annotation2400031 1 aacC1 (GmR) range2400031 1 831 1298 annotation2400026 1 Circularisation spacer region range2400026 1 1 27 annotation2400029 1 aeBlue range2400029 1 110 808 annotation2400027 1 attC recombination site range2400027 1 34 93 annotation2400028 1 rbs (aeBlue) range2400028 1 95 102 annotation2400030 1 rbs (aacC1) range2400030 1 817 823 BBa_K1388001_sequence 1 taccgagggacagactaccaactcacagctagcgcctaacaattcgtccaagccgacgccgcttcgcggcgcggcttaactcaggtgttaggcaaaggaggttattgatatggcttcactggttaaaaaagacatgtgcatcaaaatgacgatggaaggaacagtaaacggtcaccatttcaagtgtgtaggagaaggcgaaggcaaaccatttgaagggacccaggtggaaaagatacgcatcactgaaggtgggcccttaccatttgcgtatgatattttggccccttgttgcatgtatggcagtaaaaccttcattaagcatgtgtcgggtattccggattactttaaggagtcttttcctgagggctttacctgggaaagaacacaaatcttcgaggatggcggctatctcaccatacaccaggacacgagccttcagggtaataattttattttcaaagttaatgtcatcggtgccaacttccctgcaaacggtcccgtgatgcagaaaaaaacagctggatgggaaccgtgcgttgagatgctttatccgcgggacggcgtcctgtgtggtcagagcctgatggccctgaaatgcactgatggcaatcatctgacgtcccacctgcgcactacctatcgttctcgcaagccatccaatgcagttaacatgccggaatttcattttggggatcatcgcattgagattttgaaagctgaacaaggtaaattttatgaacaatacgagtcagcggtggcccgttactgtgaggcggcaccgagtaaattagggcatcactaataaaggatccaaaggaggctcaagtatgggcatcattcgcacatgtaggctcggccctgaccaagtcaaatccatgcgggctgctcttgatcttttcggtcgtgagttcggagacgtagccacctactcccaacatcagccggactccgattacctcgggaacttgctccgtagtaagacattcatcgcgcttgctgccttcgaccaagaagcggttgttggcgctctcgcggcttacgttctgcccaggtttgagcagccgcgtagtgagatctatatctatgatctcgcagtctccggcgagcaccggaggcagggcattgccaccgcgctcatcaatctcctcaagcatgaggccaacgcgcttggtgcttatgtgatctacgtgcaagcagattacggtgacgatcccgcagtggctctctatacaaagttgggcatacgggaagaagtgatgcactttgatatcgacccaagtaccgccacctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z