BBa_K1391003 1 BBa_K1391003 CD79B 2014-10-09T11:00:00Z 2015-05-08T01:10:14Z Human genome This is a protein found natively in B cells. CD79 is a heterodimer of CD79A and CD79B that is part of signal transduction in the B-cell receptor. The IgM Heavy chain, IgM light chain, CD79A subunit, and CD79B subunit require processing in the ER and must all be expressed in order to membrane localize instead of being retained in the ER by quality checking mechanisms. Binding to the antigen (beta-amyloid) causes two BCR complexes to dimerize. This allowsLyn to phosphorylate the CD79 heterodimer which causes the recruitment of Syk. As a warning, recruited Syk can cause cross talk with native cell signaling pathways as can other proteins. Care must be taken to check protein interactions and point mutate Syk if needed. We attach a protease (TEV protease) to Syk and a transcriptional activator (Gal4-VP16) to CD79 using a cleavage site (TEV cleavage site). When The BCR is activated by our antigen, Syk-TEVp cleaves the cleavage sit and releases Gal4-VP16 which can activate a synthetic system. false false _1768_ 0 22906 9 It's complicated false None false Alexa Garcia BBa_K1391003_sequence 1 atggccaggctggcgttgtctcctgtgcccagccactggatggtggcgttgctgctgctgctctcagctgagccagtaccagcagccagatcggaggaccggtaccggaatcccaaaggtagtgcttgttcgcggatctggcagagcccacgtttcatagccaggaaacggggcttcacggtgaaaatgcactgctacatgaacagcgcctccggcaatgtgagctggctctggaagcaggagatggacgagaatccccagcagctgaagctggaaaagggccgcatggaagagtcccagaacgaatctctcgccaccctcaccatccaaggcatccggtttgaggacaatggcatctacttctgccagcagaagtgcaacaacacctcggaggtctaccagggctgcggcacagagctgcgagtcatgggattcagcaccttggcacagctgaagcagaggaacacgctgaaggatggtatcatcatgatccagacgctgctgatcatcctcttcatcatcgtgcctatcttcctgctgctggacaaggatgacagcaaggctggcatggaggaagatcacacctacgagggcctggacattgaccagacagccacctatgaggacatagtgacgctgcggacaggggaagtgaagtggtctgtaggtgagcacccaggccaggagtagtag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z