BBa_K1391134 1 BBa_K1391134 miRNA 125b target site 2014-10-18T11:00:00Z 2015-05-08T01:10:15Z It was syntehsized as the reverse complement of the actual sequence for miR-125b This part contains 4 repeats of the same miRNA target site sequence for miR-125b. false false _1768_ 0 22917 9 Not in stock false The sequences had to be design as single strands which then would have to be annealed together. false Gary Burnett BBa_K1391134_sequence 1 tcacaagttagcgtctcagggatcacaagttagcgtctcagggatcacaagttagcgtctcagggatcacaagttagcgtctcaggga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z