BBa_B1006 1 BBa_B1006 Terminator (artificial, large, %T~>90) 2006-08-30T11:00:00Z 2015-08-31T04:07:21Z modified E. coli thr terminator, replaced all A-T pairs in stem with C-G pairs Released HQ 2013 Artificial terminator, estimated %T~>90% *8bp stem, 6nt loop *Bidirectional, estimated reverse %T~>90% false true _41_ 0 745 41 In stock false Bidirectional, with the reverse estimated to be less effective than the forward. Has a polyA tail of 9 residues. true Haiyao Huang annotation1898429 1 modified thr terminator range1898429 1 10 31 annotation1898431 1 PolyA range1898431 1 1 9 annotation1898430 1 PolyA range1898430 1 32 39 annotation1898428 1 B1006 range1898428 1 1 39 BBa_K124014 1 BBa_K124014 Bacteriophage Holin Gene pS105 2008-10-08T11:00:00Z 2015-05-08T01:09:44Z This part was graciously donated to the Brown iGEM Team by Ry Young at Texas A&M. The Cell Lysis Cassette consists of an S, R, and Rz protein. When paired with an activator, the cassette is expressed and cell lysis is induced. The S105 strain of the cassette has the initial 6 base pairs at the beginning of the wild type sequence removed. This causes cell lysis to be induced at a faster rate than the wild type. false false _221_ 0 3367 9 It's complicated true No design considerations. true Katherine Jacobs BBa_K1392971 1 BBa_K1392971 Holin+Terminator 2014-10-09T11:00:00Z 2015-05-08T01:10:15Z Brown iGEM Team by Ry Young at Texas A&M Modified E. coli thr terminator, replaced all A-T pairs in stem with C-G pairs This part comes from a Bacteriophage Holin Gene pS105 This is a variation of the S gene of the "Cell Lysis Cassette." When it is paired with an activator, the cassette is expressed and cell lysis is induced. The S105 gene has the initial 6 base pairs at the beginning of the wild type S gene sequence removed. This causes cell lysis to be induced at a faster rate than the wild type. The added Terminator is artificial and large. false false _1769_ 0 16902 9 It's complicated false No design considerations during Holin Gene Bidirectional, with the reverse estimated to be more effective than the forward. Has a polyA tail of 9 residues. false Şeniz Y??ksel İlkem Kumru component2415817 1 BBa_B1006 component2415812 1 BBa_K124014 annotation2415817 1 BBa_B1006 range2415817 1 326 364 annotation2415812 1 BBa_K124014 range2415812 1 1 317 BBa_K124014_sequence 1 gctgctaaaaaagccggagtagaagatggtagaaatcaataagcaatctcgcttatataacgagcgtgtttatcggctacatcggtactgactcgattggttcgcttatcaaacgcttctataatggcggtgcgtttacaaaaacagtaatcgacgcaacgatgtgcgccattatcgcctggttcattcgtgaccttctcgacttcgccggactaagtatgccagaaaaacatgacctgttggccgccattctcgcggcaaaggaacaaggcatcggggcaatccttgcgtttgcaatggcgtaccttcgcggcaga BBa_B1006_sequence 1 aaaaaaaaaccccgcccctgacagggcggggtttttttt BBa_K1392971_sequence 1 gctgctaaaaaagccggagtagaagatggtagaaatcaataagcaatctcgcttatataacgagcgtgtttatcggctacatcggtactgactcgattggttcgcttatcaaacgcttctataatggcggtgcgtttacaaaaacagtaatcgacgcaacgatgtgcgccattatcgcctggttcattcgtgaccttctcgacttcgccggactaagtatgccagaaaaacatgacctgttggccgccattctcgcggcaaaggaacaaggcatcggggcaatccttgcgtttgcaatggcgtaccttcgcggcagatactagagaaaaaaaaaccccgcccctgacagggcggggtttttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z