BBa_K1393001 1 BBa_K1393001 OprF(Ala196)+CBP 2014-10-01T11:00:00Z 2015-07-22T02:48:08Z The OprF gene is from Pseudomonas aeruginosa. The OprF is a major outer membrane protein of Pseudomonas aeruginosa. This protein functions as a nonspecific porin to allow the passage of small hydrophilic molecules, plays a structural role in maintaining cell shape and outer membrane integrity, and is required for growth under low osmolality. The structure of OprF has been proposed to consist of three domains, the N-terminal forming h-barrel structure, a loop or hinge region, and the C-terminal associated with peptidoglycan. Based on the predicted secondary structure and information found in the literature, we chose Ala196 as potential fusion sites for displaying CBP. CBP is the abbreviation of copper binding peptide made up of seven amino acid. false false _1770_ 4206 20256 9 In stock false Based on the predicted secondary structure and information found in the literature, we chose Val(188) as potential fusion sites for displaying CBP. CBP is the abbreviation of copper binding peptide made up of seven amino acid. false Jiajun Tan annotation2391717 1 CBP range2391717 1 589 609 annotation2391711 1 oprF to Ala196 range2391711 1 1 588 BBa_K1393001_sequence 1 atgaaactgaagaacaccttaggcgttgtcatcggctcgctggttgccgcttcggcaatgaacgcctttgcccagggccagaactcggtagagatcgaagccttcggcaagcgctacttcaccgacagcgttcgcaacatgaagaacgcggacctgtacggcggctcgatcggttacttcctgaccgacgacgtcgagctggcgctgtcctacggtgagtaccatgacgttcgtggcacctacgaaaccggcaacaagaaggtccacggcaacctgacctccctggacgccatctaccacttcggtaccccgggcgtaggtctgcgtccgtacgtgtcggctggtctggctcaccagaacatcaccaacatcaacagcgacagccaaggccgtcagcagatgaccatggccaacatcggcgctggtctgaagtactacttcaccgagaacttcttcgccaaggccagcctcgacggccagtacggtctggagaagcgtgacaacggtcaccagggcgagtggatggctggcctgggcgtcggcttcaacttcggtggttcgaaagccgctccggctccggaaccggtttccccgcatcatggcggctgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z